Dataset: 11.1K articles from the COVID-19 Open Research Dataset (PMC Open Access subset)
All articles are made available under a Creative Commons or similar license. Specific licensing information for individual articles can be found in the PMC source and CORD-19 metadata
.
More datasets: Wikipedia | CORD-19

Logo Beuth University of Applied Sciences Berlin

Made by DATEXIS (Data Science and Text-based Information Systems) at Beuth University of Applied Sciences Berlin

Deep Learning Technology: Sebastian Arnold, Betty van Aken, Paul Grundmann, Felix A. Gers and Alexander Löser. Learning Contextualized Document Representations for Healthcare Answer Retrieval. The Web Conference 2020 (WWW'20)

Funded by The Federal Ministry for Economic Affairs and Energy; Grant: 01MD19013D, Smart-MD Project, Digital Technologies

Imprint / Contact

Highlight for Query ‹Enzootic Pneumonia of Pigs risk

A Sensitive Assay for Virus Discovery in Respiratory Clinical

Samples

Introduction

Respiratory tract infection is the most common cause of hospitalization of children

below the age of 5 years,. In 5–40% of these hospitalizations no

infectious agent can be identified but it is suspected that a viral infection is

involved–[5]. In these cases a yet unknown virus might be the cause of

respiratory illness.

In the last decades several viral discovery methods have been developed which can

detect viruses without knowledge of the genome sequence. We have previously used

virus discovery cDNA-AFLP (VIDISCA) to discover the human coronavirus NL63

(HCoV-NL63) and we were the first to describe human parechovirus type

5 and 6 in the Netherlands using the same technique. In the VIDISCA assay viral

genomes (which are (reverse-) transcribed into double stranded DNA) are digested

with restriction enzymes. The enzymes digest short (4 nucleotides) recognition

sequences that are present in virtually all viruses. After ligation of adaptors, the

digested fragments are PCR amplified with adaptor-specific primers. The assay is

user-friendly however the sensitivity of the assay is low. At least 1 E6 genome

copies/ml of a virus in a background that is low in competitor RNA/DNA are needed.

These conditions are generally only met when virus culture supernatant is used. In

clinical respiratory samples like nasopharyngeal swabs in universal transport medium

(UTM) various amounts of competitor RNA/DNA from disrupted cells/bacteria can be

present. Ribosomal RNA, which is ∼80% of the total cellular RNA, is one

of the biggest problems due to its high copy number and its stability within

ribosomes. In particular RNA viruses are difficult to discover since in these cases

a reverse transcription is needed, which will enable rRNA to act as competiting

nucleic acid sequences.

One research group has addressed the problem of competing rRNA. Endoh et al showed that reverse

transcription with 96 hexamers that can not anneal to rRNA, decreases the amount of

background amplification and enhances the sensitivity of a virus discovery assay. We

evaluated the benefit of the non-rRNA-hexamers in VIDISCA. Furthermore, we evaluated

whether the choice of the restriction enzyme can decrease rRNA amplification.

Finally, specific blocking of rRNA reverse transcription by rRNA recognizing

oligo's that contain a 3′ dideoxy-C6 modification (which can not be

extended), further inhibits cDNA synthesis of the target. All three steps to

decrease the effect of inhibitor rRNA are presented in this paper. Furthermore we

monitored the performance of the optimized amplification in a high throughput

sequencing setting, by combining VIDISCA with Roche 454 GS FLX Titanium

sequencing.

1) non-rRNA-hexamers in the reverse transcription reaction

Endoh and colleagues designed a mix of 96 hexamers that do not or hardly

target rRNA but can amplify all known viruses by RT-PCR. These

non-rRNA-hexamers were tested in VIDISCA by using a dilution range of human

echovirus 18 culture supernatant (1 E8–1 E4 copies/ml), a virus

harvest of which we established that it contains competitor rRNA. The cDNA

was produced either with normal hexamers (containing the 4096 variants) or

non-rRNA-hexamers. Viral sequences could be detected in samples with a

concentration of 1 E6 to 1 E8 viral genomic RNA copies/ml (see in figure 1A) in case

non-rRNA-hexamers are used in the RT reaction, whereas the sample that was

treated with the normal random hexamers was only positive in the highest

concentration (1 E8 copies/ml). Moreover, 3 viral fragments were amplified

in the non-rRNA-hexamer amplification, whereas only 1 viral fragment was

amplified with the standard procedure (figure 1A). Figure 1B shows that the enhanced

sensitivity is caused by reduced competitor rRNA amplification, since the

PCR fragment that originates from rRNA is notably reduced (arrow in figure 1B).

To quantify the inhibition of rRNA amplification we performed various

real-time PCRs targeting cDNA of 28S rRNA and 18S rRNA using 2

nasopharyngeal swabs (I and II) as input. Both samples contained high

concentrations of rRNA. The samples were reverse transcribed with either the

complete set of hexamers or the non-rRNA-hexamers. With non-rRNA-hexamers

substantially lower amounts of rRNA-derived cDNA was generated with on

average more than 1 log decrease, compared to the samples treated with

random hexamers (see table

1). We observed that the decreased cDNA synthesis on the

3700-region of 28S rRNA and 1000-region of 18S rRNA was considerable

(∼3,5 Ct = 1 log), however, not as strong as the

decrease at regions 40–110 and 1780–1880 of 28S rRNA (almost 2

log decrease, table

1). Inspecting the non-rRNA-hexamers revealed that this phenomenon

can be explained by residual priming by the non-rRNA-hexamers. Although the

primers are designed to anneal not or hardly to rRNA, some do perfectly

match with human rRNA, especially in the region 3800 to 4000 (position 3803,

3840, 4040), and the same for 18S rRNA region 1100 till 1200 (position 1121,

1123, 1134, 1185, 1187, 1207). However, in the regions where we show strong

decrease in rRNA cDNA synthesis (40–110 128S rRNA and 1780–1880

18S rRNA), non-rRNA-hexamer can not anneal at the 3′site at close

vicinity (position 1613 and 2272 respectively). One might suggest expelling

the 8 hexamers that anneal at the abovementioned locations to further

enhance the benefit of non-rRNA cDNA synthesis. However, Endoh et al

designed the non-ribosomal hexamers such that amplification of viruses is

not hampered, therefore we recommend using all 96 Endoh-designed non-rRNA

hexamers.

To check whether viral amplification is not hampered by using the

non-rRNA-hexamers for cDNA synthesis we performed real-time PCRs on cDNA of

HCoV-NL63, echovirus 18, and human coxsackievirus A16 virus culture

supernatant. In all cases the cDNA synthesis with non-rRNA-hexamers occurs

as efficient as normal hexamers, as no difference in virus specific real

time PCRs was noted (Table

2). The same has been demonstrated by Endohet al

for SARS-CoV and bovine PIV-3 control viruses.

2) non-rRNA targeting restriction enzymes during digestion

The original VIDSICA method described in 2004 is based on amplification after

digestion with 2 restriction enzymes (Hinp1-I and

MseI). Investigation of

human rRNAs revealed that 28S rRNA contains a very high number of

Hinp1-I recognition sites (85, see table 3), but relatively

low frequency of MseI restriction sites. The high frequency

of HinP1-I digestion in 28S rRNA and the generation of a

massive amount of small digested fragments likely interferes in the

VIDISCA-ligation. VIDISCA can also be performed with only one restriction

enzyme, the only adaptation needed is the addition of 2 different adaptors

that both can ligate to MseI digested fragments. We checked

our hypothesis by digesting coxsackievirus B4 culture supernatant with only

MseI in comparison to the Hinp1-I/MseI

combination, and evaluated the efficiency of viral genome amplification in a

single PCR. We observed a strongly reduced background amplification in case

only MseI was used in VIDISCA (Figure 2, dots all indicate viral

fragments).

3) rRNA-blocking oligos in the reverse transcription reaction

To improve the sensitivity of VIDISCA even further we designed

oligonucleotides to block amplification of ribosomal RNA. These

oligonucleotides were designed to anneal specifically to 18S and 28S rRNA

and contain a 3′ dideoxy C6 amino modification to inhibit the

elongation and thus the amplification of rRNA-derived cDNA. These so called

rRNA-blocking oligo's were designed on the most prevalent rRNA

sequences retrieved from VIDISCA experiments with nasopharyngeal swabs. To

test the inhibitory capacity of the blocking oligo's we performed

VIDISCA with a nasopharyngeal sample as input. Blocking oligo's were

added during reverse transcriptase reaction, and inhibition was observed

when blocking oligo's were added (indicated as arrow in figure 3). Sequencing of

the inhibited PCR products confirmed that they were derived from rRNA

indicating that the blocking oligo's can reduce the amplification of

rRNA.

In addition we performed a real-time RT-PCR targeting 18S and 28S rRNA. As

input 2 nasopharyngeal samples were used (same samples that were used with

the non-rRNA annealing hexamers). We monitored cDNA synthesis via real time

PCRs at 3 regions of 28S rRNA and 1 region of 18S rRNA. The choice for these

regions to monitor the rRNA-cDNA reverse trancription efficiency was based

on the VIDISCA fragments of which we know that they are generated in VIDISCA

amplification. Three of the 4 regions are targeted by the rRNA-blocking

oligo's. On average a 50% reduction of rRNA amplification was

noticed at the regions that were targeted by the rRNA-blocking oligo's

(see Table 1). Of

note, the reduction was not visible in the fragment that was not targeted by

a blocker (1780–1880 of 28S rRNA), which is as expected. One exception

was observed however. In sample II no diminished signal was observed at 18S

rRNA 1000-region. This sample had extremely high concentrations of rRNA (Ct

value 16), thus we investigated whether the rRNA-blocking oligo's would

work better in this sample when higher concentrations of the blockers were

used. Indeed, with 25 µM and 50 µM a decrease in signal was

noted (36.9% decrease and 70.1% decrease, respectively)

indicating that in some samples a concentration of 10 µM might be

suboptimal. However, to diminish the chance of unspecific blocking of viral

RNA, we prefer the 10 µM concentration of rRNA-blocking oligo's.

With this concentration we observed no decrease in cDNA synthesis on

HCoV-NL63 and coxsackievirus B4 (measured by real-time RT-PCR, (table 4) ).

VIDISCA combined with high throughput sequencing

In figure 1 it is shown that

the sensitivity of VIDISCA reaches 1 E6 viral genome copies/ml. Although this is

an improvement, this detection limit might be too low to detect viruses directly

in clinical samples. The concentration of respiratory viruses in nasopharyngeal

swabs is in the main below 1 E6 copies/ml, and we can assume that a yet unknown

virus will be present in similar concentrations. Thus additional improvement of

the VIDISCA-sensitivity is needed. High throughput sequencing is a relatively

new method allowing millions of nucleotides to be sequenced in only one run

(pyrosequencing). One of these devices is the 454 FLX/Titanium system of Roche

which can generate over 1.000.000 DNA fragments of approximately 500 nucleotides

per run. By generating thousands of clonal amplified sequences from a single

sample, a viral minority can be detected. The VIDISCA technique can easily be

adapted for 454-FLX sequencing (VIDISCA-454 method). The anchors that are

ligated to the digested fragment can be designed to contain the “A”

and “B” primer sequence that are needed for clonal amplification in

an emulsion PCR to be used as input for 454 FLX sequencing.

However, VIDISCA-454 only becomes cost-effective in case a few thousand sequences

are sufficient for virus detection, as one 454 plate can then be used to analyze

56 samples (roughly 200 € per sample). In that view VIDISCA-454 benefits

strongly from the aforementioned reduction in rRNA amplification since fewer

sequences are needed to detect a viral sequence.

We monitored the efficiency of VIDISCA-454 in 18 nasopharyngeal swabs that

contain known viruses. Only one third of a 454 picotiterplate was used, to check

whether indeed a few thousand sequences are enough for virus detection. Samples

were selected randomly from a large sample set collected during the GRACE study,

a large EU financed study on acute cough and antibiotic use in adults. The 18

samples were assigned positive via specific diagnostic PCRs, but supplied to us

double blind to ensure unbiased sequence analyses. Each sample was processed

with its own identifier sequence that allows pooling during emulsion PCR.

VIDISCA-454 products were visualized on agarose gel and fragments were cut from

gel at different size regions (200–300,

300–500 and 500–700 bp). Samples were run on

1.3 regions of a 4 regions Picotiterplate for the 454 Titanium system (per

region 14 MID tagged samples were pooled) and processed according to the small

volume emulsion PCR. In total 202.975 reads were generated of which 4406 were

viral (2.2%). In 11 out of 18 samples viral sequences could be identified

which all matched with the respiratory virus that was found in diagnostic PCRs

(Table 5). The

frequency of viral sequences per sample ranged between 0.01% and

40.5% (Table 5).

The median viral load in the VIDISCA-454 positive samples was 7.2 E5 viral

genome copies/ml (ranging from 1.4 E3–7.6 E6 genome copies/ml). Detection

was correlated to input viral load since the very low load samples remained

negative in VIDISCA-454 (median viral genome concentration in VIDISCA-negative

samples 3.5 E3; range 6.0 E2–1.1 E5). For most VIDISCA-454 positive

samples large genome coverage was observed, see table 5.

Discussion

Nowadays molecular techniques are becoming the standard for the discovery of new

viruses. Some methods use a conserved region for universal primer design, based on

the known viral genomes–[11]. These methods are applicable to specific virus families,

but cannot be used for all viruses. Furthermore, some yet unknown viruses could be

too diverse and therefore remain negative in these kind of detection techniques

[7]. Sequence

independent amplification methods, such as VIDISCA and random-PCR, can identify

viral sequences without prior knowledge of a viral genome. Unfortunately, the

detection of unknown viral pathogens in respiratory clinical material is difficult

with these sequence independent virus discovery methods because of low viral load

and high background nucleic acids in these samples. During the last years sequence

independent virus discovery techniques were mostly used with virus culture

supernatant, as they contain high concentrations of viral genomes,, or to

discover previously unknown DNA viruses–[15]. So far no study has been able

to identify novel human respiratory RNA viruses with sequence independent

amplification techniques. Thus sequence independent amplification techniques like

VIDISCA have to be optimized to allow discovery without requiring a culture

amplification step.

In the current study we increased the sensitivity of VIDISCA by 1) reducing

background rRNA amplification, and 2) by increasing the number of sequences obtained

from a sample. We managed to unfavor rRNA amplification by adjusting the reverse

transcription step. Utilization of primers during cDNA synthesis that poorly

recognize rRNA, in combination with the addition of oligo's that halt cDNA

synthesis on rRNA templates successfully decreased interfering background

amplification. Additionally, using a single restriction enzyme with low numbers of

recognition sites in 28S rRNA provided further reduction of useless and interfering

amplification. Thus all steps increased the ratio of viral genome versus rRNA

amplifications, and the benefit was shown in VIDISCA-high throughput sequencing of

clinical samples containing known viruses. In the majority of clinical samples the

virus was easily identified by VIDISCA-454 (11 of 18). In two cases even an input of

140 and 190 genome copies of an adenovirus and influenza A virus could be detected

by VIDISCA-454. Ideally, old-protocol VIDISCA-454 (two restriction enzymes, random

hexamers and no rRNA-blocking oligo's) should have been compared with optimized

VIDISCA-454. However, this comparison is regrettably not possible due to limitation

of the respiratory clinical specimens that we used. Thus we rely on all the

reconstructions and monitoring performed with normal VIDISCA.

As mentioned above, the use of one restriction enzyme (MseI)

diminished background rRNA amplification. There is one additional advantage of

single restriction enzyme usage. In the traditional VIDISCA two restriction enzymes

were combined (MseI and HinP1-I) and only

fragments that have one restriction site on the 5′ site and the other in the

3′ site are amplified after ligation. Such VIDISCA amplification is restricted

in case one of the two enzymes has few recognition sites, or when the position of

the sites is not optimal (too far or too close from each other). By using only one

restriction enzyme, large parts of the genome would be divided in amplifiable

products, provided that the fragment size is between 50 and 600 bp. In case of

single restriction enzyme digestion, both anchors can potentially ligate to both

MseI generated sticky end but only AB or BA containing

fragments can be used for sequencing. This might give the suggestion that 50%

of the VIDISCA products are ineffective as they contain the same adaptor (AA and

BB). However, the fragments containing 2 different primers are preferentially

amplified in the PCR, since an AA or BB fragment has a disadvantage that 5′

and 3′ ends anneal to each other which interferes with primer annealing. We

definitely observed the higher chance of amplification of several genome segments

when only one restriction site is used. Remarkably high genome coverage was noted in

several samples (reaching >70% for the samples containing RSV and

HCoV-OC43), a coverage which could never be achieved in case two restriction enzymes

were used in amplifications.

Other groups have used high throughput sequencing for virus discovery as well. In one

paper the viral community in an Antarctic lake was described. Lopez-Bueno et

al. collected water in spring and late summer from a fresh water lake

(Limnopolar lake) in Antarctica and used high throughput sequencing to study the

viral community in a location hardly visited by larger eukaryotes. For the first

time a large amount of sequence data was retrieved from this isolated place which

led to the identification of at least 12 viral families of which two are claimed to

represent new families. Their results show the enormous possibilities for virus

discovery and high throughput sequencing. The authors also address a large amount of

unknown sequences present in their data set. We also observed the presence of

unknown sequences within our data set. It could be that these sequences are derived

from yet unknown viruses, or it could be that the sequences are part of a genomic

sequence from a known organism, e.g. a bacterium of which not the complete genomic

sequence is present in the Genbank databases. Thus care should be taken to assign

sequences as potentially viral, since so many organisms have not been fully

sequenced.

There are several advantages of high throughput sequencing in comparison to BigDye

terminator sequencing. First of all, with high throughput sequencing and pooling of

samples that carry their own recognition sequence the VIDISCA cost per sample is

reduced, since selective VIDISCA-PCR, metaphor agarose gel visualization,

purification of fragments from gel, TA cloning, colony PCR and subsequent BigDye

sequencing can all be omitted. Secondly, the amount of sequence data received from a

single sample is higher than what can be achieved in standard VIDSCA, thus

increasing the chances of identifying an unknown virus. This method opens new

opportunities for virus discovery, not only in respiratory samples of undiagnosed

respiratory infection, but also in diseases such as Amyotrophic lateral sclerosis

(ALS), Kawasaki disease (KD) and Multiple sclerosis (MS). For these syndromes a

viral pathogen has been suggested–[19] but could not be confirmed so far. With VIDISCA-454 it is

now possible to investigate samples from these patients for unknown viruses.

Ethics Statement

Patients were randomly chosen from the large European EU-financed GRACE study

(https://www.grace-lrti.org). Ethics review committees in each

country approved the study, Cardiff and Southampton (United Kingdom):

Southampton & South West Hampshire Research Ethics Committee A; Utrecht

(Netherlands) Medisch Ethische Toetsingscommissie Universitair Medisch Centrum

Utrecht; Barcelona (Spain) Comitè ètic d'investigació

clínica Hospital Clínic de Barcelona; Mataro (Spain):

Comitè d'Ètica d'Investigació Clínica

(CEIC) del Consorci Sanitari del Maresme; Rotenburg (Germany) Ethik-Kommission

der Medizinischen Fakultät der Georg-August-Universität

Göttingen, Antwerpen (Belgium): UZ Antwerpen Comité voor Medische

Ethiek; Lodz, Szeczecin, and Bialystok (Poland): Komisja Bioetyki Uniwersytetu

Medycznego W Lodzi; Milano (Italy) IRCCS Fondazione Cà Granda

Policlinico; Jonkoping (Sweden): Regionala etikprövningsnämnden i

Linköping; Bratislava (Slovakia): Etika Komisia Bratislavskeho; Gent

(Belgium): Ethisch Comité Universitair Ziekenhuis Gent; Nice (France)

Comité de Protection des Personnes Sud-Méditerranée II,

Hôpital Salvator; Jesenice (Slovenia): Komisija Republike Slovenije za

Medicinsko Etiko. Written informed consent was provided by all study

participants.

Clinical samples and viruses

HCoV-NL63, echovirus 18, human coxsackievirus A16 and human coxsackievirus B4

were cultured on an epithelial monkey kidney cell line (LLC-MK2) in MEM

Hank's/Earle's (2∶1) medium (Invitrogen) with 3%

inactivated fetal bovine serum (FBS; Cambrex Bio Science). Both media were

supplemented with penicillin (0.1 mg/ml) and streptomycin (0.1 mg/ml) (Duchefa

Biochemie). Viruses were harvested on day 2 except human coronavirus NL63

(HCoV-NL63) which was harvested at day 7.

During the GRACE study, a large EU financed study on acute cough and antibiotic

use in adults consulting their general practitioner, flocked nasopharyngeal

swabs (Copan) in universal transport medium (UTM) were collected from all

patients. Eighteen of these nasopharyngeal specimens were randomly selected

(double blind) and included in this study and proven positive by specific

diagnostic PCR's for either human rhinovirus (HRV), respiratory syncytial

virus (RSV), human coronavirus OC43 (HCoV-OC43), HCoV-NL63, Influenzavirus A,

Influenzavirus B, parainfluenzavirus 3 (PIV3) or adenovirus. The diagnostics for

the respiratory viruses were determined by in-house multiplex real-time PCR

assays–[22], all primers and probes

are available on request. Viral loads were determined by virus-specific

quantative real time PCRs using standard curves based on plasmids containing the

virus sequence of interest (details available on request).

Real time RT-PCR for enterovirus, HCoV-NL63 and rRNA

Nucleid acids were extracted by Boom isolation. Elution of nucleic acids was

performed in sterile H2O or in 10 µM of rRNA-blocking

oligonucleotides (2 µM each, see below). The reverse transcription was

performed as described with the adjustment that in some cases 25 ng of random

hexamers (Amersham Biosciences) or non-ribosomal hexamers were used. Enterovirus

real-time PCR was performed to quantify the efficiency of echovirus 18, human

coxsackievirus A16 and human coxsackievirus B4 reverse transcription reactions,

whereas a specific HCoV-NL63 real time PCR was performed to quantify the

HCoV-NL63 reverse transcription efficiency,. Ribosomal RNA real time PCR

was performed with the primers below, and the Quantifast SYBR Green PCR kit

(Qiagen). Real-time PCR with primerset 5/6 was additionally run with a probe

(rRNA28S_3674 5′-FAM-GGGTGTTGACGCGATGTGATTTCT-TAMRA-3′) and

the platinum quantitative PCR Supermix-UDG system (Invitrogen).

VIDISCA

VIDISCA was performed as described with some adaptations. In short, cell debris

and mitochondria were removed by centrifugation and residual DNA was degraded

with 20 U TURBO™ DNase (Ambion). Nucleic acid isolation was performed as

described by Boom et al.[23], elution in H2O

with or without 10 µM rRNA-blocking oligonucleotides:

Reverse transcription was performed with 2.5 µg of random hexamers

(Amersham Biosciences) or 2.5 µg non-ribosomal hexamers and 200 U of

Moloney murine leukemia virus reverse transcriptase enzyme (Invitrogen). After

the RT reaction, second strand synthesis was performed with 5 U Klenow frament

(3′ - 5′ exo-) (Westburg) and 7.5 U of RNase H (Amersham) followed

by a phenol chloroform extraction and ethanol precipitation. The digestion was

performed for 2h at 37°C by 10 U of HinP1-I (New England

Biolabs) and 10U of MseI (New England Biolabs) restriction

enzymes or only by 10U of MseI (New England Biolabs). Ligation

of MSE and HINP anchors was performed as described. In case of single

MseI digestion a 2nd MSE anchor was added

(MID1-top-A 5′-GCCTCCCTCICGCCATCAGACGAGTGCGTA-3′;

MID1-bottom-A 5′-TATACGCACTCGTCTGATGGCGCGAGGGAGGC-3′; Top-B

5′-

GCCTTGCCAGCCCGCTCAGA-3′; Bottom-B 5′-TATCTGAGCGGGCTGGCAAGGC-3′). The first round of

PCR amplification was performed with primers annealing to the anchors and covers

20 cycles, or 45 cycles in case only a single PCR was used. A second PCR was

used to enhance the signal using primers that are extended at the 3′ with

one nucleotide (either A, T, C, or G) so a total of 16 primer combinations. PCR

fragments were visualized on 3% metaphor agarose gels (Cambrex),

fragments of interest were cut from gel, purified with NucleoSpin® Extract

II (Macherey-Nagel), cloned using TOPO TA cloning kit (Invitrogen) and sequenced

with BidDye terminator reagents (Applied Biosystems). Data analysis was

conducted with CodonCode Aligner software and BLAST.

VIDISCA-454

VIDISCA was performed as described above with minor changes (Figure 4). Reverse transcription was

performed with Superscript II (200 U, Invitrogen) in a mixture containing E.coli

ligase (5 U, Invitrogen). The anchor ligation was performed with anchors, based

on primer A with an identifier sequence (MIDs of 10 nt see GS FLX Shotgun DNA

Library Preparation Method Manual) and 1 anchor containing primer B. In total 14

different identifier sequences were used, allowing 14 samples to be pooled.

Amplification in a single PCR was performed with 0.4 µM of primer A-MID

(5′- CGTATCGCCTCCCTCGCGCCATCAG

-3′) and 0.4 µM of primer B (5′- CTATGCGCCTTGCCAGCCCGCTCAG

-3′) with the following thermo-cycling profile: 1

cycle of 94°C for 5 min, 40 cycles of 94°C for 60 s, 55°C for 60 s

and 72°C for 2 min, and 1 cycle of 72°C for 10 min. Of each sample 15

µl of product was loaded on a 1% agarose gel and 3 size regions

were cut from gel: 200–300 bp, 300–500 bp and 500–700. Each

size region was purified with NucleoSpin® Extract II (Macherey-Nagel). DNA

was quantified with the Quant-iT™ dsDNA Assay Kit on a Qubit

fluorometer (Invitrogen). Emulsion PCR was performed according to the suppliers

protocol (LIB-A SV emPCR kit, GS FLX Titanium PicoTiterPlate kit (70×75),

GS FLX Titanium XLR 70 Sequencing kit (Roche)). Each emulsion PCR amplifies

fragments of 14 different samples. Samples were run on a 4 regions

Picotiterplate for the 454 Titanium system (per region 14 samples were run) and

processed according to the emulsion small volume PCR protocol with 2 E6 beads

per emulsion as input and 4 small volume emulsions per region (direct titration

protocol). Sequence reads were assembled using the CodonCode software (www.codoncode.com) and the search for viral sequences was

performed with the Blast tool of Genbank.