Initially, interferons-α nebulization, broad-spectrum antibiotics, and anti-viral drugs were used to reduce the viral load,,, however, only remdesivir has shown promising impact against the virus. Remdesivir only and in combination with chloroquine or interferon beta significantly blocked the SARS-CoV-2 replication and patients were declared as clinically recovered,,. Various other anti-virals are currently being evaluated against infection. Nafamostat, Nitazoxanide, Ribavirin, Penciclovir, Favipiravir, Ritonavir, AAK1, Baricitinib, and Arbidol exhibited moderate results when tested against infection in patients and in-vitro clinical isolates,,,. Several other combinations, such as combining the antiviral or antibiotics with traditional Chinese medicines were also evaluated against SARS-CoV-2 induced infection in humans and mice. Recently in Shanghai, doctors isolated the blood plasma from clinically recovered patients of COVID-19 and injected it in the infected patients who showed positive results with rapid recovery. In a recent study, it was identified that monoclonal antibody (CR3022) binds with the spike RBD of SARS-CoV-2. This is likely due to the antibody’s epitope not overlapping with the divergent ACE2 receptor-binding motif. CR3022 has the potential to be developed as a therapeutic candidate, alone or in combination with other neutralizing antibodies for the prevention and treatment of COVID-19 infection.

As the case count and death toll of the epidemic continue to increase, it becomes imperative to identify therapeutic options for COVID-19. Once in vitro and in vivo systems have been established, these tests can proceed. Drug repurposing may prove to be the best strategy for quick development of novel therapeutic options. A novel therapeutic being tested is remdesivir (19, 20), which in combination with chloroquine has been found to inhibit SARS-CoV-2 growth in vitro (21). It was recently announced by the NIH that remdesivir would be entering phase 3 clinical trials in humans. Chloroquine has also been reported to be effective in patients in China (22). A combination of lopinavir and ritonavir is also under investigation in human cases of COVID-19 in China. Many more people will need to be treated with these drugs to determine true efficacy, but they are promising leads.

After an initial push to look for therapeutic and vaccine options to help treat and prevent COVID-19, it will be important to better understand the host response to infection and the pathology of disease. A prerequisite step will of course be the development of appropriate animal models. Better understanding of how SARS-CoV-2 causes pathology and the way in which the host responds may help direct further therapeutic avenues. Understanding how comorbidities such as diabetes impact the host response to infection will also be important to better understand COVID-19.

There is no available vaccine against COVID-19, while previous vaccines or strategies used to develop a vaccine against SARS-CoV can be effective. Recombinant protein from the Urbani (AY278741) strain of SARS-CoV was administered to mice and hamsters, resulted in the production of neutralizing antibodies and protection against SARS-CoV,. The DNA fragment, inactivated whole virus or live-vectored strain of SARS-CoV (AY278741), significantly reduced the viral infection in various animal models,,,,,. Different other strains of SARS-CoV were also used to produce inactivated or live-vectored vaccines which efficiently reduced the viral load in animal models. These strains include, Tor2 (AY274119),, Utah (AY714217), FRA (AY310120), HKU-39849 (AY278491),, BJ01 (AY278488),, NS1 (AY508724), ZJ01 (AY297028), GD01 (AY278489) and GZ50 (AY304495). However, there are few vaccines in the pipeline against SARS-CoV-2. The mRNA based vaccine prepared by the US National Institute of Allergy and Infectious Diseases against SARS-CoV-2 is under phase 1 trial. INO-4800-DNA based vaccine will be soon available for human testing. Chinese Centre for Disease Control and Prevention (CDC) working on the development of an inactivated virus vaccine,. Soon mRNA based vaccine’s sample (prepared by Stermirna Therapeutics) will be available. GeoVax-BravoVax is working to develop a Modified Vaccina Ankara (MVA) based vaccine. While Clover Biopharmaceuticals is developing a recombinant 2019-nCoV S protein subunit-trimer based vaccine.

Although research teams all over the world are working to investigate the key features, pathogenesis and treatment options, it is deemed necessary to focus on competitive therapeutic options and cross-resistance of other vaccines. For instance, there is a possibility that vaccines for other diseases such as rubella or measles can create cross-resistance for SARS-CoV-2. This statement of cross-resistance is based on the observations that children in china were found less vulnerable to infection as compared to the elder population, while children are being largely vaccinated for measles in China.

As an emerging virus, there is no effective drug or vaccine approved for the treatment of SARS-CoV-2 infection yet. Currently, supportive care is provided to the patients, including oxygen therapy, antibiotic treatment, and antifungal treatment, extra-corporeal membrane oxygenation (ECMO) etc. 21,22. To search for an antiviral drug effective in treating SARS-CoV-2 infection, Wang and colleagues evaluated seven drugs, namely, ribavirin, penciclovir, nitazoxanide, nafamostat, chloroquine, remdesivir (GS-5734) and favipiravir (T-750) against the infection of SARS-CoV-2 on Vero E6 cells in vitro

63. Among these seven drugs, chloroquine and remdesivir demonstrated the most powerful antiviral activities with low cytotoxicity. The effective concentration (EC50) for chloroquine and remdesivir were 0.77µM and 1.13µM respectively. Chloroquine functions at both viral entry and post-entry stages of the SARS-CoV-2 infection in Vero E6 cells whereas remdesivir does at post-entry stage only. Chloroquine is a drug used for an autoimmune disease and malarial infection with potential broad-spectrum antiviral activities 64,65. An EC90 (6.90 µM) against the SARS-CoV-2 in Vero E6 cells is clinically achievable in vivo according to a previous clinical trial 66. Remdesivir is a drug currently under the development for Ebola virus infection and is effective to a broad range of viruses including SARS-CoV and MERS-CoV 67,68. Functioning as an adenosine analogue targeting RdRp, Remdesivir can result in premature termination during the virus transcription 69,70. The EC90 of remdesivir against SARS-CoV-2 in Vero E6 cells is 1.76 µM, which is achievable in vivo based on a trial in nonhuman primate experiment 63,69. Encouragingly, in the first case of SARS-CoV-2 infection in the United States, treatment with remdesivir was provided intravenously to the patient on the day 7 without any adverse events observed. The patient's clinical condition was improved on day 8 and the previous bilateral lower-lobe rales disappeared, implying the remdesivir might be effective to the treatment of SARS-CoV-2 infection 22. This result, however, should be interpreted with caution as this is only single case study and a proper trial control was lacking. In addition, baricitinib, a Janus kinase inhibitor, was also predicted to reduce the ability of virus to infect lung cell by an analysis of BenevolentAI 71.

Currently, chloroquine and remdesivir are under phase 3 clinical trial and open-label trial for treatment of SARS-CoV-2 infection respectively (Table 2) 72. Preliminary results showed that chloroquine phosphate had apparent efficacy in treatment of COVID-19 73. However, caution must be taken during clinical use of chloroquine as its overdose is highly fatal without known antidote 74. Despite the lack of documented in vitro data supporting the antiviral efficacy on SARS-CoV-2, several antiviral chemotherapeutic agents have been registered for the clinical trials for the treatment of COVID-19 (Table 2) 72.

SARS-CoV-2 is an emerging pathogen, without any effective drug available for treatment at the moment. It spreads quickly and can result in death of the infected patients. Despite the current mortality rate is 2.3% 26, the emergence of large number of infected patients within short period of time could result in the collapse of health care system, and thus the mortality rate might be elevated. Effective preventive measures must be implemented to control it from global spreading. In addition, great effort should be made on the development of vaccine and antiviral drugs. Meanwhile, the intermediate host and the molecular mechanism of its cross-species spread should be further investigated. Legislation should be employed to prohibit the trade of wild animals, the potential intermediate host(s) of various viruses, to prevent the outbreak of this and other novel viruses in future.

Based on the experience of fighting the epidemic SARS-CoV and MERS-CoV previously, we may learn some lessons for some treatment strategies against coronavirus. Antiviral drugs and systemic corticosteroid treatment commonly used in clinical practice previously, including neuraminidase inhibitors (oseltamivir, peramivir, zanamivir, etc), ganciclovir, acyclovir, and ribavirin, as well as methylprednisolone [46, 75] for influenza virus, are invalid for COVID-19 and not recommended. Remdesivir (GS-5734) is a 1′-cyano-substituted adenosine nucleotide analog prodrug and shows broad-spectrum antiviral activity against several RNA viruses. Based on the data collected from in vitro cell line and mouse model, remdesivir could interfere with the NSP12 polymerase even in the setting of intact ExoN proofreading activity. Remdesivir has been reported to treat the first US case of COVID-19 successfully. Chloroquine is a repurposed drug with great potential to treat COVID-19. Chloroquine has been used to treat malaria for many years, with a mechanism that is not well understood against some viral infections. Several possible mechanisms are investigated: Chloroquine can inhibit pH-dependent steps of the replication of several viruses, with a potent effect on SARS-CoV infection and spread. Moreover, chloroquine has immunomodulatory effects, suppressing the production/release of TNF-α and IL-6. It also works as a novel class of autophagy inhibitor, which may interfere with viral infection and replication. Several studies have found that chloroquine interfered with the glycosylation of cellular receptors of SARS-CoV and functioned at both entry and at post-entry stages of the COVID-19 infection in Vero E6 cells. A combination of remdesivir and chloroquine was proven to effectively inhibit the recently emerged SARS-CoV-2 in vitro.

Scientists previously confirmed that the protease inhibitors lopinavir and ritonavir, used to treat infection with human immunodeficiency virus (HIV), could improve the outcome of MERS-CoV and SARS-CoV patients. It has reported that β-coronavirus viral loads of a COVID-19 patient in Korea significantly decreased after lopinavir/ritonavir (Kaletra®, AbbVie, North Chicago, IL, USA) treatment. Additionally, clinicians combined Chinese and Western medicine treatment including lopinavir/ritonavir (Kaletra®), arbidol, and Shufeng Jiedu Capsule (SFJDC, a traditional Chinese medicine) and gained significant improvement in pneumonia associated symptoms in Shanghai Public Health Clinical Center, China.The other antiviral drugs include nitazoxanide, favipiravir, nafamostat, and so on (See Table 1 for details).

Given the lack of effective antiviral therapy against COVID-19, current treatments mainly focused on symptomatic and respiratory support according to the Diagnosis and Treatment of Pneumonia Caused by COVID-19 (updated to version 6) issued by National Health Commission of the People’s Republic of China. Nearly all patients accepted oxygen therapy, and WHO recommended extracorporeal membrane oxygenation (ECMO) to patients with refractory hypoxemia. Rescue treatment with convalescent plasma and immunoglobulin G are delivered to some critical cases according to their conditions.

At the time of writing, no effective antiviral therapy has been confirmed. However, intravenous administration with remdesivir, a nucleotide analog, has been found to be efficacious in an American patient with COVID-19 64. Remdesivir is a novel antiviral drug developed by Gilead initially for the treatment of diseases caused by Ebola and Marlburg viruses 76. Later, remdesivir also demonstrated possible inhibition of other single stranded RNA viruses including MERS and SARS viruses 77,78. Based on these, Gilead has provided the compound to China to conduct a pair of trials on SARS-CoV-2-infected individuals 79, and the results are highly anticipated.

In addition, baricitinb, interferon-α, lopinavir/ritonavir, and ribavirin have been suggested as potential therapies for patients with acute respiratory symptoms 80,81. Diarrhea, nausea, vomiting, liver damage, and other adverse reactions can occur following combined therapy with lopinavir/ritonavir 80. The interaction of these treatments with other drugs used in the patients should be monitored carefully.

It has been known that a cytokine storm results from an overreaction of the immune system in SARS and MERS patients 33. Cytokine storm is a form of systemic inflammatory response featured by the release of a series of cytokines including TNFα, IL-1β, IL-2, IL-6, IFNα, IFNβ, IFNγ, and MCP-1. These cytokines induce immune cells to release a vast number of free radicals which are the major cause of ARDS and multiple organ failure 67. Immunosuppression is essential in the treatment of cytokine storms, especially in severe patients.

Corticosteroids and tocilizumab, an anti-IL6 monoclonal antibody, have been used to treat cytokine storm 68. Other immunosuppression treatments for cytokine storm include the modulation of T cell-directed immune response; the blockade of IFN-γ, IL-1, and TNF; JAK inhibition 69; blinatumomab 70; suppressor of cytokine signaling 4 71; and HDAC inhibitors 72.

Steroids, as immunosuppressants, were widely used in the treatment of SARS to reduce the severity of inflammatory damage 65. However, steroids at high dosages were not beneficial to severe lung injury in SARS and COVID-19 patients 59,73. Instead, they may cause severe side effects, especially avascular osteonecrosis, dramatically affecting the prognosis 74. Nevertheless, short courses of corticosteroids at low-to-moderate doses have been recommended to be used prudently for critically ill COVID-19 patients 75.

Due to the absence of a specific antiviral therapeutics and vaccine, main treatment strategy for COVID-19 is supportive care, which is supplemented by the combination of broad-spectrum antibiotics, antivirals, corticosteroids and convalescent plasma 16 (Table 1). HIV protease inhibitors ritonavir and lopinavir have been used, typically in combination with appropriate antibiotics or with IFNα-2b, in the treatment of SARS-CoV-2 infected patients 7, 17. Nucleoside analogs such as ribavirin 12 may be potentially beneficial for the treatment of COVID-19, since ribavirin was approved for treating respiratory syncytial virus (RSV) infection 18 and used extensively during the SARS and MERS outbreak 10. However, ribavirin had severe side effects such as anemia 18 and whether it had sufficient antiviral activity against SARS-CoV-2 is unclear. Nucleoside analogs favipiravir (T-705) can effectively inhibit the activity of RNA polymerase of RNA viruses such as influenza 19. A recent in vitro study found that it had the anti-SARS-CoV-2 activity 20, but the in vivo effect remains elusive. Remdesivir may be the most promising antiviral drug for treating COVID-19. It has in vitro and in vivo antiviral activity against a wide array of RNA viruses including SARS and MERS 21, and could decrease viral loads and pathology of lungs in animal models 22. A study showed remdesivir markedly inhibited the infection of SARS-CoV-2 in Vero E6 cells 20, and most symptoms of the first US patient infected with SARS-CoV-2 had resolved swiftly after intravenous administration with remdesivir 23. Currently, it is under clinical trial to evaluate the safety and efficacy of intravenous remdesivir for patients with SARS-CoV-2 infection 24. Oral oseltamivir has been used for the treatment of the cases with SARS-CoV-2 7, while its efficacy currently remains uncertain.

Host-targeted small molecules approved for other human diseases may modulate the virus-host interactions of SARS-CoV-2. Chloroquine, a potential broad-spectrum antiviral drug 25, 26, was shown by a recent study had anti-SARS-CoV-2 activity 20. Its clinical efficacy is under study in an open-label trial (ChiCTR2000029609) 12. IFNα (5 million U) atomization inhalation was recommended as antiviral therapy to treat SARS-CoV-2 16. A trial testing IFNα-2b combination of the approved anti-HCV inhibitors has been initiated 17, however, whether it could act synergistically against SARS-CoV-2 is unclear.

Corticosteroids were frequently used to suppress the elevated cytokine levels in patients with SARS-CoV 27, 28 and MERS-CoV 29, 30. However, there are no evidence showing that the mortality of SARS and MERS patients was reduced by the treatment with corticosteroids, while the clearance of viral was delayed by such treatment 31-33. Consequently, corticosteroids are not suggested to systemically use in SARS-CoV-2 infected patients 34, 35.

Previously, it was shown that, either in severe influenza or SARS-CoV infection, convalescent plasma treatment could significantly decrease viral load and reduce the mortality 31, 36. Convalescent plasma has been used for severe SARS-CoV-2 infection in China 22, although promising, the efficacy and safety need to be carefully further evaluated.

Consistent with previous analysis, WHO also concluded "to date, there is no specific medicine recommended to prevent or treat SARS-CoV-2" 37. TCM has been used in control of infectious diseases for thousands of years. There is a clear room for the intervention of TCM as a complementary therapy for COVID-19 patients. It is reported that the patients with SARS-CoV infection have benefited from TCM treatment 38, including amelioration of side effect of conventional therapeutics 39, 40. Based on these factors, there is a general expectation that TCM would be a valuable weapon in the armory against SARS-CoV-2.

The availability of therapeutic NAbs against SARS-CoV-2 will offer benefits for the control of the current pandemic and the possible re-emergence of the virus in the future, and their development therefore remains a high priority. The efforts of NAb development will surely be an area of intense research in the coming months and even years. Currently, several strategies are used in the clinic or under development, such as viral-targeting therapeutics and host-targeting agents (such as interferons, glucocorticoids) for the treatment of COVID-19. As compared with these therapeutic strategies, NAbs appear to be more specific for virions. Understanding of action mechanisms of NAbs may provide valuable implications for the rapid development of antibody therapy and vaccine for SARS-CoV-2. However, the development of NAb-based therapeutics is a time-consuming and laborious process. To date, no NAb agents for either SARS-CoV or (Middle East Respiratory Syndrome Coronavirus) MERS-CoV are available in the market. Meanwhile, a note of caution is that the effect of antibody immune response in protecting against pulmonary pathogenesis of SARS-CoV is controversial 31. Some patients who died of SARS showed the strong NAb responses and pulmonary proinflammatory accumulation, suggesting NAbs could be associated with fatal acute lung injury. Therefore, it is important to take insight into humoral and cellular responses of SARS-CoV-2 when antiviral immunotherapy is developed.

As most patients develop an immunity against the SARS-CoV and survive the infection, the possibility of creating an effective and safe vaccine seems to exist. There are several options to develop vaccines against the SARS-CoV.

A further strategy is based on the use of epitopes which can be delivered using viral or DNA vectors. Such an epitope-based strategy for coronavirus vaccination has already been reported and the major advantages is the prevention of a possible vaccine reversion to virulence. A further benefit of this technique is the possibility to eliminate any regions of the viral genomic sequence which be associated with a potential autoimmune effects. The limitation of this approach is mainly based on potential variations. In this respect, epitopes which frequently undergo mutations will not protect against the SARS-CoV infections if used in epitope-based vaccines. If the SARS-CoV evolves as a highly variable virus, it will be crucial to identify highly conserved epitopes of the virus.

In summary, the important development of SARS vaccines can be approached using several techniques which should ideally encompass the induction of both humoral and cell-mediated mechanisms. As coronavirus vaccines in animals have partly been reported to cause an enhancement of viral infections, a cautious approach has to be followed. A first study has investigated the ability of adenoviral delivery of a codon-optimised SARS-CoV spike protein S1 fragment, membrane protein, and nucleocapsid protein to induce immunity in rhesus macaques. The immunization with a combination of these three Ad5-SARS-CoV vectors and a booster vaccination on day 28 demonstrated antibody responses against the spike protein S1 fragment. Also T-cell responses against the nucleocapsid protein were found and all vaccinated animals displayed strong neutralising antibody responses in vitro. These results indicated that an adenoviral-based vaccine can induce SARS-CoV-specific immune responses in monkeys.

The simplest and most direct approach to combating SARS-CoV-2 during the outbreak would be to use plasma from the convalescent patients 48. Polyclonal NAbs could be induced in some convalescent patients and will be effective in treating SARS-CoV-2 12. These NAbs can provide passive immune responses to viral infection. Indeed, both SARS and Ebola patients received the treatment of convalescent plasma 49,50. However, the outcomes of passive plasma therapy are unpredictable due to variability of sera in different patients.

Development of NAbs against SARS-CoV-2 is a relatively rapid approach to obtain the standardized agents that control re-emergence of COVID-19 51. The SARS-CoV-2 S protein is likely important target for developing NAbs to block binding and fusion of SARS-CoV-2 (Figure 2). SARS-CoV-2 seems to use the same cell entry receptor, ACE2, as the SARS-CoV because ACE2 shows binding to RBD of both SARS-CoV and SARS-CoV-2 11. However, a recent study demonstrates that SARS-CoV-2 S protein binds ACE2 with higher affinity than SARS-CoV (10- to 20-folder) 13, suggesting its recognition to ACE2 could be different with SARS-CoV. Although SARS-CoV-2 shows the high homology with SARS-CoV, antibody cross-reactivity is limited between the two virus S proteins. Several published SARS-CoV NAbs do not have appreciable binding to SARS-CoV-2 S protein 13,52. A recent study shows that a SARS-CoV antibody, CR3022, binds to SARS-CoV-2 RBD 52, but its neutralization capability is uncertain. Cocktail of NAbs has showed the stronger neutralization than alone in treatment of both Ebola and SARS viruses 47,53. This finding suggests that a cocktail antibody approach for SARS-CoV-2 could be undertaken. Therefore, it will be very meaningful to generate NAbs targeting different epitopes on SARS-CoV-2. Combination of several potent NAbs could decrease the probability for escape virus isolates with decreased sensitivity to neutralization.

Computational simulation of antibody-antigen complexes has been used to guide the design of therapeutic antibodies 54-56. Numbers of antibody structures (currently around 2,000 depositions) are available in the Protein Data Bank [PDB]. Based on these PDB data, the comparative model of an antibody onto the viral surface antigen can be predicted. The key residues between RBD and NAbs can be identified to provide important implications for the vaccines against SARS-CoV-2. The key residues of interface between an antibody and the antigen can be optimized to produce high affinity 57. Several recent computer docking models have been used to predict the interaction between S protein and human ACE2 10 or antibodies 52. The studies revealed the important discovery that SARS-CoV-specific CR3022 antibody could cross-react to SARS-CoV-2.

None.

Control number of visiting patients

Reducing outpatient visitors will be critical to decrease cross-infection. Patients are asked to make an appointment before going to the hospital.

b)Make good use of online platforms

Online platforms such as the hospital’s official website or WeChat should be well utilized. Online platforms can provide notice for decreasing outpatient visits and updates on COVID-19, help patients distinguish between urgent and non-urgent ocular diseases, recommend safe and self-executing treatments for common nonurgent ocular diseases, remind patients to prepare correct personal protection before coming to the hospital, advise patients with suspicious symptoms such as fever to first visit the screening center before coming to the ophthalmic clinic, and give targeted guidance for common chronic eye diseases during this period.

c)Online ordering and delivery of prescribed medication

Both hospital and patients can benefit from submitting prescriptions online and having patient medication sent to their doorsteps via non-contact delivery.

Unlike SARS-CoV, which resolved without more reported cases, continued outbreaks of MERS-CoV present an ongoing threat to public health. It should be noted that no specific treatment is currently available for HCoVs, and further research into the pathogenesis of HCoV infection is therefore imperative to identify appropriate therapeutic targets. Accordingly, at present, the prevention of viral transmission is of utmost importance to limit the spread of MERS. The enormous ratio of nosocomial infections indicates that preventive measures in hospitals have not been sufficiently implemented. Additionally, as an emerging zoonotic virus, prevention of transmission from dromedary camels is another possibility to reduce the quantity of MERS cases. Regarding clinical therapies, a combination of treatment administered as early as possible and aimed at synchronously disrupting viral replication, inhibiting viral dissemination, and restraining the host response is likely to be most suitable, due to the acute clinical features of MERS with diffuse lung damage and the important role of immunopathology.

Potential treatments must undergo in vitro and in vivo studies to select the most promising options. The development of stable and reproducible animal models of MERS, especially in NHPs, is therefore a decisive step forward. The next step in the development of standardized and controllable therapies against SARS and MERS will be clinical trials in humans, validating a standard protocol for dosage and timing, and accruing data in real time during future outbreaks to monitor specific adverse effects and help inform treatment.

The comprehensive lessons and experiences that have resulted from the outbreaks of SARS and MERS provide valuable insight and advancements in how to react to future emerging and re-emerging infectious agents. Rapid identification of the pathogen via effective diagnostic assays is the first step, followed by the implementation of preventive measures, including raising awareness of the new agent, reporting and recording (suspected) cases, and infection control management in medical facilities. Studies are currently needed that focus on the epidemiology of these organisms, especially in terms of pathogen transmission and potential reservoirs and/or intermediate hosts. Animal models and prophylactic and therapeutic approaches should be promoted, followed by fast-tracked clinical trials.

Our increasing understanding of novel emerging coronaviruses will be accompanied by increasing opportunities for the reasonable design of therapeutics. Importantly, understanding this basic information will not only aid our public health preparedness against SARS-CoV and MERS-CoV, but also help prepare for novel coronaviruses that may emerge.

This study was conducted during the first three months (March-May 2003) of the SARS outbreak in Beijing, China, where Ditan Hospital was designated as a 'SARS hospital', meaning that suspected SARS patients were transferred and managed at this institution. The study was approved by the Ethics Committee of the Beijing Ditan Hospital. The clinical case definition of probable SARS included a fever of ≥38°C, cough or shortness of breath, new pulmonary infiltrates on chest radiography, and close contact with a suspect or probable SARS case. Day 1 was defined as the day of fever onset.

Sera, throat washes and feces were collected from hospitalised patients for testing with a quantitative SARS-CoV RT-PCR. As the early phase of the outbreak in Beijing had involved many healthcare workers, patient self-collected throat washes and fecal samples were used to minimize further nosocomial transmission. For throat washes, patients were given 10 ml of sterile 0.9% NaCl, asked to gargle for 30 seconds then spit the fluid into a 20 ml sterile plastic screw-topped plastic container. Patients were also asked to collect approximately 1 cm3 feces and place it into a 20 ml sterile screw-topped plastic container.

Five ml of the throat wash was centrifuged at 10,000 g for 10 minutes, then the supernatant further centrifuged at 20,000 g for 1 hour. Ten ml of 0.01 M phosphate buffered saline (pH 7.2) was used to dilute the fecal sample, then 5 ml was centrifuged at 10,000 g for 10 minutes. The supernatant was further centrifuged at 20,000 g for 1 hour. RNA was extracted from the remaining 100–300 μl of the throat wash and fecal pellets using Trizol (Invitrogen, Beijing, PR China). 700 μl of sera were centrifuged at 20,000 g for 1 hour, the supernatant removed and RNA extracted from the remaining 100–300 μl pellet using Trizol.

SARS-CoV RNA was detected in throat washes, stool and blood using a fluorescence quantitative RT-PCR assay (ShenZhen PJ Biotech Company, Shenzhen, Guangdong Province, PR China), according to the manufacturer's instructions and performed on a BioRad iCycler thermal cycler (Bio-Rad Laboratories, Beijing, PR China). The SARS-CoV pol region primers used were P1 sense 5'GTTCTTGCTCGCAAACATAACACTT3' (position 15279–15303 in SARS-CoV Urbani strain, Genbank accession number AY278741), P2 antisense 5'AACAGCTTGACAAATGTTAAAGACA3' (15446–15470) and probe 5'TGTGTGGCGGCTCACTATAT3' (15373–15392). Internal controls were used in all runs, and no evidence of PCR inhibition in clinical samples was detected. Testing for other respiratory viruses was not carried out in this cohort of patients as they fitted the SARS clinical case definition during the outbreak. The PCR assay was negative when performed on RNA or DNA extracted from influenza A and B, rhinovirus, respiratory syncytial virus and adenovirus isolates, and on plasma collected from otherwise healthy hepatitis C and B infected individuals (data not shown).

Manipulations were carried out in a BSL2 facility with BSL3 practices. SARS-CoV isolation was not attempted on clinical samples during the outbreak due to safety concerns and time constraints.

SARS-CoV infection results in a severe respiratory disease. It causes significant nosocomial infection and requires aggressive infection control practices rarely used for other causes of atypical pneumonia. Laboratory confirmation of SARS is crucial in the management of patients presenting with pneumonia, particularly as the clinical features of SARS make it difficult to distinguish from other causes of atypical pneumonia. Molecular methods for SARS diagnosis are useful, although their value is affected by the observation that maximal viral shedding occurs after the first week of illness rather than at the initial clinical presentation. The SARS outbreak was characterized by high infection rates in healthcare workers; patient self-collected specimens such as throat washes or feces, or serum may pose less risk to healthcare workers, particularly in the context of concerns about nosocomial acquisition. Although NPAs and other lower respiratory tract samples are the sample of choice for suspected respiratory viral infections, patient self-collected specimens are suitable for RT-PCR. Thus they offer diagnostic value, especially in SARS where the peak of viral shedding is after the first week of illness, and this sampling approach may reduce the safety issues of healthcare workers collecting NPAs. Patient self-collected specimens may be less appropriate for common seasonal respiratory virus infections such as influenza, where viral shedding is maximal at clinical presentation and virus is rarely detected outside the respiratory tract. Accurate and rapid laboratory diagnosis will become even more important as SARS becomes less common, or in the event of new outbreaks of SARS, especially if influenza or other seasonal respiratory viruses are co-circulating.

Practice social distancing in the registration and waiting areas

Patients should stay at least 1.5 m apart from one another when in registration and waiting area.

b)Limit the number of people in the room

Keeping 1 doctor and 1 patient in 1 room is required except for visually impaired patients, patients with communication/mobility difficulties or parents of small children. The room should be well-ventilated. After each patient’s consultation or treatment, the used instruments such as slit lamp must be disinfected immediately.

c)Reduce outpatient examinations

Operation of many ophthalmic equipment requires close proximity, reducing outpatient examinations helps protect both doctors and patients.

Micro-aerosols can be generated when non-contact tonometry is used. Air-puff ophthalmic equipment like non-contact tonometry should be avoided if unnecessary. It is advised to place the tonometer in a ventilated place, and that the measurement interval between patients should be extended. During the measurement, patients should wear a face mask.

Direct ophthalmoscope examination is not recommended, which can be replaced by slit light lens or fundus photography. Protective shields (better transparent) should be installed on slit lamps and any other equipment used which needs close doctor-patient contact. Both doctor and patient should refrain from bare face-to-face speaking during any examination.

All work with animals was conducted in strict accordance with the Institutional Animal Care and Use Committee (IACUC) guidelines from Southern Research Institute (SRI) or Lovelace Respiratory Research Institute (LLRI). For SRI, ferret studies were approved by the Southern Research Institute’s Institutional Animal Care and Use Committee. Southern Research Institute has Veterinary Medicine tasked to monitor and support all animal experiments. Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adheres to principles stated in the Guide for the Care and Use of Laboratory Animals, National Research Council, 1996. The facility where this research will be conducted is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International. For LLRI, The animal work was reviewed and approved by the LRRI Institutional Animal Care and Use Committee under protocol number 06–017. All work involving infectious agents are reviewed by the LRRI Infectious Agents Committee and approved. All infections and sample collections were performed under 5% isofluorane anesthesia and all efforts were made to minimize suffering.

Despite the presence of extensive research reporting on SARS-CoV and MERS-CoV therapies, it was not possible to establish whether treatments benefited patients during their outbreak. In the absence of fundamental, clinically proven, effective antiviral therapy against SARS-CoV and MERS-CoV, patients mainly receive supportive care supplemented by diverse combinations of drugs. Several approaches are being considered to treat infections of SARS-CoV and MERS-CoV (Table 4, MERS-CoV-related table previously reviewed by de Wit et al. in Nature Reviews Microbiology, 2016), including the use of antibodies, IFNs, and inhibitors of viral and host proteases.

The vital role of the S protein of SARS-CoV makes this protein an important therapeutic target, and numerous studies have explored potential therapeutics. Firstly, peptides that block RBD–ACE2-binding derived from both RBD and ACE2 could be developed as novel therapeutics against SARS-CoV infection. Secondly, peptides binding to the S protein interfere with the cleavage of S1 and S2. This step inhibits the production of functional S1 and S2 subunits and the consequent fusion of the viral envelope with the host cell membrane. Thirdly, anti-SARS-CoV peptides blocking the HR1–HR2 interaction by forming a fusion-active core have viral fusion inhibitory activity at the micromolar level. However, the potential selection of escape mutants with altered host range phenotypes is one of the disadvantages of this strategy that needs further modification. Furthermore, mouse monoclonal antibodies (mAbs) targeting assorted fragments of the SARS-CoV S protein have effectively inhibited SARS-CoV infection. A series of neutralizing human mAbs were generated from the B cells of patients infected with SARS-CoV. Another strategy used human immunoglobulin transgenic mice immunized with full-length SARS-CoV S proteins. 80R and CR3014 binding to the ACE2 receptor are examples of S-specific mAbs.

Similarly, the therapeutic agents that have been developed against MERS-CoV are based on the S protein and basically restrain the binding of receptors or the fusion of membrane proteins, thereby leading to the inhibition of MERS-CoV infection. These methods mainly involve peptidic fusion inhibitors, anti-MERS-CoV neutralizing mAbs, anti-DPP4 mAbs, DPP4 antagonists, and protease inhibitors. However, none of these anti-MERS-CoV curative agents are approved for commercial use in humans.

Another suitable and well‐established model is the common marmoset (Saguinus mystax), which can show more severe clinical signs than rhesus macaques when infected with MERS‐CoV.30, 31, 32 When administered through a combination of intraoral, intranasal and intravascular inoculation, with doses ranging from 5 × 106 TCID50 to 5 × 107 PFU, mild to moderate respiratory disease was observed, and interstitial pneumonia was observed clinically and microscopically.

When infected with SARS‐CoV, common marmosets exhibit fever, diarrhea, multifocal pneumonitis and hepatis.33 Research using this model is progressing. The common marmoset is a potential non‐human primate model for SARS‐CoV infection and deserves more attention.

The 2019-nCoV causes an ongoing outbreak of lower respiratory tract disease called novel coronavirus pneumonia (NCP) by the Chinese government initially. The disease name was subsequently recommended as COVID-19 by the World Health Organization. Meanwhile, 2019-nCoV was renamed SARS-CoV-2 by the International Committee on Taxonomy of Viruses. As of February 24, 2020, more than 80,000 confirmed cases including more than 2,700 deaths have been reported worldwide, affecting at least 37 countries. The WHO has declared this a global health emergency at the end of January 2020. The epicenter of this ongoing outbreak is in the city of Wuhan in Hubei Province of central China and the Huanan seafood wholesale market was thought to be at least one of the places where SARS-CoV-2 from an unknown animal source might have crossed the species barrier to infect humans.

A pioneering study conducted in the city of Shenzhen near Hong Kong by a group of clinicians and scientists from the University of Hong Kong has provided the first concrete evidence for human-to-human transmission of SARS-CoV-2. This is an excellent example of how a high-quality clinical study can make a major difference in policy setting. Several important clinical features of COVID-19 have also been documented in this study. First, an attack rate of 83% within the family context is alarmingly high, indicating the high transmissibility of SARS-CoV-2. Second, the clinical manifestations of COVID-19 in this family range from mild to moderate, with more systematic symptoms and more severe radiological abnormalities seen in older patients. Generally, COVID-19 appears to be less severe than SARS. Third, an asymptomatic child was found to have ground-glass opacities in his lung and SARS-CoV-2 RNA in his sputum sample. This finding of asymptomatic virus shedding raises the possibility for transmission of SARS-CoV-2 from asymptomatic carriers to others, which is later confirmed by others. Finally, the presentation of diarrhea in two young adults from the same family also suggests the possibility for gastrointestinal involvement in SARS-CoV-2 infection and fecal–oral transmission. The study has set the stage for the control and management of COVID-19. The work was completed timely and the investigators showed great courage and leadership in a very difficult time when the Chinese authority failed to recognize widespread person-to-person transmission of SARS-CoV-2 before January 20, 2020.

Several interesting papers on SARS-CoV-2 and COVID-19 have been published in the past few weeks to report on the evolutionary reservoir, possible intermediate host and genomic sequence of SARS-CoV-2 as well as clinical characteristics of COVID-19 [6, 7]. In view of these findings and the urgent needs in the prevention and control of SARS-CoV-2 and COVID-19, in this commentary we highlight the most important research questions in the field from our personal perspectives.

The first question concerns how SARS-CoV-2 is transmitted currently in the epicenter of Wuhan. In order to minimize the spreading of SARS-CoV-2, China has locked down Wuhan and nearby cities since January 23, 2020. The unprecedented control measures including suspension of all urban transportation have apparently been successful in preventing further spreading of SARS-CoV-2 to other cities. However, the number of confirmed cases in Wuhan continued to rise. It is therefore crucial to determine whether the rise is due to a large number of infected individuals before the lock down and/or failure in the prevention of widespread intra-familial, nosocomial or community transmission. Based on the number of exported cases from Wuhan to cities outside of mainland China, it was predicted that there might be more than 70,000 individuals infected with SARS-CoV-2 on January 25, 2020 in Wuhan. This should be determined experimentally in Wuhan as discussed below and it will reveal whether the real numbers of infected people and asymptomatic carriers are indeed underestimated severely. In addition to viral RNA detection, measurement of IgM and IgG antibodies as well as antigens would be very helpful. Several representative residential areas should be selected for detailed analysis so that a big picture can be deduced. The analysis should include all healthy and diseased individuals within the area with the aim of identifying people who have recovered from an infection or are having an active infection. The ratio of asymptomatic carriers should also be determined. The analysis should also be extended to detect RNA and antigen of influenza viruses. The activity of seasonal flu in Wuhan also reached a peak at the beginning of 2020. It will be of interest to see whether the flu season had ended and how many people having a fever now are actually infected with influenza virus. Precision control measures for SARS-CoV-2 should be tailor-designed for high-risk groups based on the results of this analysis. Differentiating people having a flu and preventing them from infecting with SARS-CoV-2 in a hospital setting might also be critical.

The second question is how transmissible and pathogenic is SARS-CoV-2 in tertiary and quaternary spreading within humans. Continued transmission of SARS-CoV-2 in Wuhan suggests that tertiary and quaternary spreading has occurred. Compared to the primary and secondary spreading during which SARS-CoV-2 was transmitted from animal to human and from human to human, has the transmission rate increased and has the pathogenicity decreased? Alternatively, is the virus less transmissible after several passages in humans? Retrospective analysis of all confirmed cases in Wuhan should be very informative. The answers to the above questions hold the key to the outcome of the outbreak. If the transmission is weakened, the outbreak may ultimately come to an end at which SARS-CoV-2 is eradicated from humans. On the contrary, if effective transmission can be sustained, the chance is increased that SARS-CoV-2 will become another community-acquired human coronavirus just like the other four human coronaviruses (229E, OC43, HKU1 and NL63) causing common cold only. The basic reproductive number (R0) of SARS-CoV-2 has been estimated to be 2.68, resulting in an epidemic doubling time of about 6.4 days. Other estimates of R0 could go up to 4, higher than that of SARS-CoV, which is lower than 2. Determining the real R0 will shed light on whether and to what extent infection control measures are effective.

The third question relates to the importance of asymptomatic and presymptomatic virus shedding in SARS-CoV-2 transmission. Asymptomatic and presymptomatic virus shedding posts a big challenge to infection control [1, 2]. In addition, patients with mild and unspecific symptoms are also difficult to identify and quarantine. Notably, the absence of fever in SARS-CoV-2 infection (12.1%) is more frequent than in SARS-CoV (1%) and Middle East respiratory syndrome coronavirus (MERS-CoV; 2%) infection. In light of this, the effectiveness of using fever detection as the surveillance method should be reviewed. However, based on previous studies of influenza viruses and community-acquired human coronaviruses, the viral loads in asymptomatic carriers are relatively low. If this is also the case for SARS-CoV-2, the risk should remain low. Studies on the natural history of SARS-CoV-2 infection in humans are urgently needed. Identifying a cohort of asymptomatic carriers in Wuhan and following their viral loads, clinical presentations and antibody titers over a time course will provide clues as to how many of the subjects have symptoms in a later phase, whether virus shedding from the subjects is indeed less robust, and how often they might transmit SARS-CoV-2 to others.

The fourth question relates to the importance of fecal–oral route in SARS-CoV-2 transmission. In addition to transmission via droplets and close contact, fecal–oral transmission of SARS-CoV has been shown to be important in certain circumstances. Gastrointestinal involvement of SARS-CoV-2 infection and isolation of SARS-CoV-2 from fecal samples of patients are in support of the importance of fecal–oral route in SARS-CoV-2 transmission. Although diarrhea was rarely seen in studies with large cohorts [6, 7], the possibility of SARS-CoV-2 transmission via sewage, waste, contaminated water, air condition system and aerosols cannot be underestimated, particularly in cases such as the Diamond Princess cruise ship with 3,700 people, among whom at least 742 have been confirmed to be infected with SARS-CoV-2 plausibly as the result of a superspreading event. Further investigations are required to determine the role of fecal–oral transmission in these cases and within the representative residential areas selected for detailed epidemiological studies in Wuhan as discussed earlier.

The fifth question concerns how COVID-19 should be diagnosed and what diagnostic reagents should be made available. RT-PCR-based SARS-CoV-2 RNA detection in respiratory samples provides the only specific diagnostic test at the initial phase of the outbreak. It has played a very critical role in early detection of patients infected with SARS-CoV-2 outside of Wuhan, implicating that widespread infection of the virus had occurred in Wuhan at least as early as the beginning of 2020. This has also pushed the Chinese authority to acknowledge the severity of the situation. Due to difficulties in sampling and other technical issues in this test, at one point in early February clinically diagnosed patients with typical ground glass lung opacities in chest CT were also counted as confirmed cases in order to have the patients identified and quarantined as early as possible. ELISA kits for detection of IgM and IgG antibodies against N and other SARS-CoV-2 proteins have also been available more recently. This has made specific diagnosis of ongoing and past infection possible. Particularly, seroconversion for IgM antibodies normally occurs a few days earlier than that of IgG. ELISA reagents for detection of SARS-CoV-2 antigens such as S and N are still in urgent need, and would provide another test highly complementary to viral RNA detection.

The sixth question concerns how COVID-19 should be treated and what treatment options should be made available. COVID-19 is a self-limiting disease in more than 80% of patients. Severe pneumonia occurred in about 15% of cases as revealed in studies with large cohorts of patients. The gross case fatality is 3.4% worldwide as of February 25, 2020. This rate is 4.4% for patients in Wuhan, 4.0% for patients in Hubei and 0.92% for patients outside of Hubei. The exceedingly high fatality in Wuhan might be explained by the collapse of hospitals, a large number of undiagnosed patients, suboptimal treatment or a combination of these. Up to date, we still do not have any specific anti-SARS-CoV-2 agents but an anti-Ebola drug, remdesivir, may hold the promise. As a nucleotide analog, remdesivir was shown to be effective in preventing MERS-CoV replication in monkeys. Severity of disease, viral replication, and lung damage were reduced when the drug was administered either before or after infection with MERS-CoV. These results provide the basis for a rapid test of the beneficial effects of remdesivir in COVID-19. Other antiviral agents worthy of further clinical investigations include ribavirin, protease inhibitors lopinavir and ritonavir, interferon α2b, interferon β, chloroquine phosphate, and Arbidol. However, we should also bear in mind the side effects of these antiviral agents. For example, type I interferons including interferon α2b and interferon β are well known for their antiviral activity. Their beneficial effects at an early phase of infection are well expected. However, administration at a later stage carries the risk that they might worsen the cytokine storm and exacerbate inflammation. Notably, steroids have been experimentally used widely in the treatment of SARS and are still preferred by some Chinese physicians in the treatment of COVID-19. It is said to be capable of stopping the cytokine storm and preventing lung fibrosis. However, the window in which steroids might be beneficial to patients with COVID-19 is very narrow. In other words, steroids can only be used when SARS-CoV-2 has already been eliminated by human immune response. Otherwise, SARS-CoV-2 replication will be boosted leading to exacerbation of symptoms, substantial virus shedding, as well as increased risk for nosocomial transmission and secondary infection. In this regard, it will be of interest to determine whether the report of fungal infection in the lungs of some patients in Wuhan might be linked to misuse of steroids. Nevertheless, the screening of new pharmaceuticals, small-molecule compounds and other agents that have potent anti-SARS-CoV-2 effects will successfully derive new and better lead compounds and agents that might prove useful in the treatment of COVID-19.

The seventh question is whether inactivated vaccines are a viable option for SARS-CoV-2. The chance that SARS-CoV-2 will become endemic in some areas or even pandemic has increased in view of its high transmissibility, asymptomatic and presymptomatic virus shedding, high number of patients with mild symptoms, as well as the evidence for superspreading events. Thus, vaccine development becomes necessary for prevention and ultimate eradication of SARS-CoV-2. Inactivated vaccines are one major type of conventional vaccines that could be easily produced and quickly developed. In this approach, SARS-CoV-2 virions can be chemically and/or physically inactivated to elicit neutralizing antibodies. In the case of SARS-CoV and MERS-CoV, neutralizing antibodies were successfully and robustly induced by an inactivated vaccine in all types of animal experiments, but there are concerns about antibody-dependent enhancement of viral infection and other safety issues. While inactivated vaccines should still be tested, alternative approaches include live attenuated vaccines, subunit vaccines and vectored vaccines. All of these merit further investigations and tests in animals.

The eighth question relates to the origins of SARS-CoV-2 and COVID-19. To make a long story short, two parental viruses of SARS-CoV-2 have now been identified. The first one is bat coronavirus RaTG13 found in Rhinolophus affinis from Yunnan Province and it shares 96.2% overall genome sequence identity with SARS-CoV-2. However, RaTG13 might not be the immediate ancestor of SARS-CoV-2 because it is not predicted to use the same ACE2 receptor used by SARS-CoV-2 due to sequence divergence in the receptor-binding domain sharing 89% identity in amino acid sequence with that of SARS-CoV-2. The second one is a group of betacoronaviruses found in the endangered species of small mammals known as pangolins, which are often consumed as a source of meat in southern China. They share about 90% overall nucleotide sequence identity with SARS-CoV-2 but carries a receptor-binding domain predicted to interact with ACE2 and sharing 97.4% identity in amino acid sequence with that of SARS-CoV-2. They are closely related to both SARS-CoV-2 and RaTG13, but apparently they are unlikely the immediate ancestor of SARS-CoV-2 in view of the sequence divergence over the whole genome. Many hypotheses involving recombination, convergence and adaptation have been put forward to suggest a probable evolutionary pathway for SARS-CoV-2, but none is supported by direct evidence. The jury is still out as to what animals might serve as reservoir and intermediate hosts of SARS-CoV-2. Although Huanan seafood wholesale market was suggested as the original source of SARS-CoV-2 and COVID-19, there is evidence for the involvement of other wild animal markets in Wuhan. In addition, the possibility for a human superspreader in the Huanan market has not been excluded. Further investigations are required to shed light on the origins of SARS-CoV-2 and COVID-19.

The ninth question concerns why SARS-CoV-2 is less pathogenic. If the reduced pathogenicity of SARS-CoV-2 is the result of adaptation to humans, it will be of great importance to identify the molecular basis of this adaptation. The induction of a cytokine storm is the root cause of pathogenic inflammation both in SARS and COVID-19. SARS-CoV is known to be exceedingly potent in the suppression of antiviral immunity and the activation of proinflammatory response. It is therefore intriguing to see how SARS-CoV-2 might be different from SARS-CoV in interferon-antagonizing and inflammasome-activating properties. It is noteworthy that some interferon antagonists and inflammasome activators encoded by SARS-CoV are not conserved in SARS-CoV-2. Particularly, ORF3 and ORF8 in SARS-CoV-2 are highly divergent from ORF3a and ORF8b in SARS-CoV that are known to induce NLRP3 inflammasome activation. ORF3 of SARS-CoV-2 is also significantly different from the interferon antagonist ORF3b of SARS-CoV. Thus, these viral proteins of SARS-CoV and SARS-CoV-2 should be compared for their abilities to modulate antiviral and proinflammatory responses. The hypothesis that SARS-CoV-2 might be less efficient in the suppression of antiviral response and the activation of NLRP3 inflammasome should be tested experimentally.

Much progress has been made in the surveillance and control of infectious diseases in China after the outbreak of SARS-CoV in 2003. Meanwhile, virological research in the country has also been strengthened. The new disease report and surveillance system did function relatively well during the 2009 pandemic of swine flu. New viral pathogens such as avian influenza virus H7N9 and severe-fever-with-thrombocytopenia syndrome bunyavirus have also been discovered in recent years [11, 12], indicating the strength and vigor of Chinese infectious disease surveillance and virological research. However, the ongoing outbreak of SARS-CoV-2 has not only caused significant morbidity and mortality in China, but also revealed major systematic problems in control and prevention of infectious diseases there. Unfortunately, many of the lessons from the 2003 outbreak have not been learned. Importantly, disease control professionals, practicing physicians and scientists are disconnected in the fight against SARS-CoV-2 and COVID-19. In addition, important decisions were not made by experts in the field. Hopefully, these issues will be dealt with swiftly and decisively during and after the outbreak.

Above we have discussed the two possibilities that this outbreak will unfold. If SARS-CoV-2 is not eliminated from humans through quarantine and other measures, it can still be eradicated by vaccination. If it attenuates to become another community-acquired human coronavirus causing mild respiratory tract disease resembling the other four human coronaviruses associated with common cold, it will not be a disaster either. Before SARS-CoV-2 attenuates further to a much less virulent form, early diagnosis and improved treatment of severe cases hold the key to reduce mortality. We should remain vigilant, but there are grounds for guarded optimism. Redoubling our research efforts on SARS-CoV-2 and COVID-19 will solidify the scientific basis on which important decisions are made.