Clinical signs observed including gasping, coughing or depression started to appear from three days post-challenge with APEC or a mixed APEC and IBV infection. Bacteriophage treatment delayed the onset of the clinical signs to 6 days post-challenge (dpc) and in addition markedly reduced their severity in both groups (Figure 3). Regarding IBV infection, clinical signs were observed from four-days post-challenge, with bacteriophage treatment leading to a reduction of their severity, but not delaying their onset (Figure 3).

Bacteriophage treatment was not associated with mortality in single APEC or mixed APEC and IBV infected groups. In contrast, birds challenged with APEC alone and mixed APEC and IBV infection without bacteriophage treatment showed a 16% and 29% mortality rate at 8 and 7 days post-infection respectively (Figure 4). Bacteriophage treatment in combination with single IBV infection did not reduce the mortality of 26% (Figure 4).

Bacteriophage treatment significantly reduced APEC shedding after single APEC or mixed APEC and IBV challenge, with a gradual decrease of bacterial loads in lung tissues over time. In contrast, a non-treated and challenged group showed a significantly higher APEC load with a gradual increase over time especially at 9 and 15 dpc (Figure 5). Interestingly, bacteriophage treatment significantly reduced IBV shedding in the mixed infected group but not in the IBV alone infected group comparing to the mixed infected group without bacteriophage treatment. The bacteriophage treated group infected with IBV showed relatively comparable results to the infected non-treated group. Groups with single IBV infection and mixed APEC and IBV infection with bacteriophage treatment showed a reduction, but not statistically significant, of IBV comparing to single IBV infection without bacteriophage treatment, with the reduction only becoming statistically significant at 15 dpc (Figure 6).

All tissue samples were immediately stored at −70°C until used. RNA of the samples was extracted using the Accuzol Userś Manual (BioNeer Corporation, Republic of Korea) according to the manufacturer's protocol. Briefly, appropriate tissue (50–100 mg of tissue) was homogenized with 1 mL of Accuzol, and then 200 μL chloroform was added into the mixture and the mixture was centrifuged at 12000 rpm at 4°C for 15 min. The upper phase was added to an equal volume of isopropyl alcohol and stored at −20°C for 10 min then centrifuged at 12000 rpm at 4°C for 10 min. After the washing step, by using 80% ethanol and centrifuging at 12000 rpm at 4°C for 5 min, the pellet was dissolved in a final volume of 50 μL distilled water (DW) and stored at −70°C until used.

Six 12-month-old purpose-bred female ferrets (Mustela putorius furo), seronegative for currently circulating influenza A (pH1N1 and H3N2) and B viruses and Aleutian disease virus, weighing 600–900 g., were obtained from a commercial breeder (Euroferret). Animals were housed and they received water and food ad libitum. The experiments were conducted in strict compliance with European guidelines (EU directive on animal testing 86/609/EEC) and Dutch legislation (Experiments on Animals Act, 1997). The protocol was approved by an independent animal experimental ethical review committee DCC in Driebergen, The Netherlands. Animal welfare was monitored on a daily basis. Virus inoculation of ferrets was performed under anesthesia with a mixture of ketamine/medetomidine (10 and 0.05 mg/kg resp.) antagonized by atipamezole (0.25 mg/kg). All animal handling (swabbing and weighing) was performed under light anesthesia using ketamine to minimize animal suffering. All experiments with ferrets were performed under animal biosafety level 3 conditions in class 3 isolator cages.

The ferrets were inoculated intratracheally with 106 median tissue culture infectious dose (TCID50) of Seal/H10N7 in a 3-ml volume. Clinical scores were assessed daily and the activity status was scored as follows: 0, alert and playful; 1, alert and playful only when stimulated; 2, alert but not playful when stimulated; 3, neither alert nor playful when stimulated. For diarrhea, sneezing, nasal discharge, inappetence and dyspnea we scored: 0, not present; 1, present. Dyspnea was characterized by open-mouth breathing with exaggerated abdominal movement. Body weight was monitored daily. Humane endpoints in case of severe disease prior to the experimental endpoint were set to 20% of weight loss over the course of the experiment, 15% weight loss in a day or activity score 3. Nasal and pharyngeal swabs were collected every day and were stored at -80°C in transport medium (Hank’s balanced salt solution containing 10% of glycerol, 200U/ml P, 200 mg/ml S, 100U/ml polymyxin B sulphate (Sigma Aldrich) and 250 mg/ml gentamycin [ICN, Netherlands]) until end-point titration in MDCK cells. At 3 and 7 dpi, three animals were euthanized by exsanguination. Necropsies were performed according to a standard protocol and the following samples were taken for virological, histopathological and immunohistochemical analyses: nasal turbinates, trachea, bronchus, lung, tracheo-bronchial lymph nodes, tonsils, heart, liver, spleen, kidneys, adrenal glands, pancreas, jejunum, olfactory bulb, cerebellum and cerebrum. Tissues for virological examination were homogenized in transport medium using the FastPrep system (MP Biomedicals) with 2 one-quarter-inch ceramic sphere balls, centrifuged at 1500 g for 10 min, aliquoted and stored at -80°C until end-point titration in MDCK cells. Tissues for histological examination were fixed in 10% neutral-buffered formalin, embedded in paraffin wax, sectioned at 4 μm, and stained with HE for light microscopical examination. For detection of influenza A virus antigen by immunohistochemistry, sequential slides of all tissues were stained with a primary antibody against the influenza A nucleoprotein as described previously. In each staining procedure, an isotype control was included as a negative control and a lung section from a cat infected experimentally with high pathogenic influenza virus (HPAI) H5N1 was used as positive control.

At present, antiviral drugs are available in fighting influenza, such as the M2 inhibitors and the neuraminidase inhibitors. Nonetheless, the emergence of drug resistant influenza strains raises concern over their effectiveness. It has been reported that M2 inhibitors resistant H5N1 viruses are widespread. The efficacy of the neuraminidase inhibitor, oseltamivir, appears to be very time dependant, where treatment started later than 24 hours post infection is much less effective. Therefore other alternative antiviral drugs are required to fight H5N1 influenza. In vaccination, it is well known that influenza viruses are dynamic and are continuously evolving. Influenza type A viruses undergo antigenic drift and antigenic shift, resulting in new virus strains that may not be recognized by antibodies to earlier influenza strains. Therefore, rational design of vaccines against influenza vaccines still has a long way to go. Although there are difficulties of tackling influenza virus with drugs or vaccines, they are very useful in the prevention and therapy of influenza. At the same time, effective diagnostic tests for viruses screening prior to application of drugs and vaccines are widely accepted, due to their simplicity, rapidity and applicability.

Indirect enzyme-linked immunosorbent assay test (ELISA) was done to analyze the serum samples. Commercially available ELISA kits (BioChek®, Reeuwijk, Netherlands) of ART, ORT, ILT, and IBV were used to detect the antibodies. Serum samples were diluted at 1:50 dilution in dilution buffer, followed by 1:10 dilution, and final dilution of 1:500 was used as working samples for respective ELISA. 100 μl of negative and positive controls was added into antibody coated plate wells A1, B1 and C1, D1, respectively, remaining 92 wells were filled with samples. After that, plate incubated at room temperature for 30 min in case of IBV and 60 min in case of ART, ORT, and ILT. Meanwhile, conjugate and wash solutions were prepared according to manufacturer’s instructions. After incubation, contents of wells were aspirated and washed four times with wash buffer (350 μl). Then, the plate was inverted and tapped firmly on absorbent paper to remove the moisture. Then, 100 μl conjugate reagents were added on each well. Again, the plate was incubated for 30 min at room temperature in case of IBV and 60 min in case of ART, ORT, and ILT, respectively. After incubation, washed the plate with wash buffer following the procedure described previously. Then, the wells of microtiter plate were filled with substrate and incubated for 15 min at 22°C–27°C in case of IBV and 30 min for ART, ORT, and ILT. After incubation, the reaction was stopped by adding 100 μl stop solutions. Finally, the optical density value of each sample was measured at 405 nm within 15 min after adding stop solution, and the results were recorded by calculating sample to positive (S/P) ratio and antibody titer.

Over the surveillance period, sewage water samples were collected from poultry farms and used for the isolation of bacteriophages specific to APEC O78. Samples were centrifuged at 10,000 rpm for 10 min and then filtered through a 0.22 μm filter (Millipore). Bacteriophage purification and enrichment was performed in accordance with. Briefly, filtered samples were mixed with Luria Bertani (LB) broth (Sigma), early-log grown APEC O78 added and samples incubated overnight at 37ºC with shaking set to 120 rpm/min. Then, samples were centrifuged at 10,000 rpm for 10 min and filtered through a 0.22 μm filter. The presence of bacteriophages was initially tested by the spot test method based on the double layer plaque technique in accordance with. For this, 100 µl of APEC O78 were cultured on LB agar for 8 h, then 10 µl of the prepared bacteriophage suspension spotted onto it, and plates incubated at 37ºC overnight. The appearance of a clear zone in the plate indicated the presence of the lytic phage. Plaque assay was used for the titration of bacteriophages as previously described.

Ninety-one-day-old commercial broiler chicks were divided randomly into two groups (seventy chicks in the experimental and twenty chicks in the control group). They were reared separately in the Animal Research Unit of the Veterinary School of Shiraz University and received feed and water ad libitum during the experiment. All experiments were conducted after institutional approval of the animal use committee of Shiraz University. Prior to challenge, all birds were serologically tested using enzyme-linked immunosorbent assay (ELISA) and they were negative for antibodies to infectious bronchitis virus antigens. Furthermore, five birds from the experimental group were killed and their organs were investigated for virus detection. At the age of 20 days, all birds in the experimental group were challenged intranasally and with allantoic fluid containing 105 ELD50/0.1 mL of the virus. The remaining 20 birds were left as unchallenged control. All the chickens were monitored daily for 20 days for clinical signs, antibody responses to IBV, and mortality. On days 1, 2, 3, 5, 7, 11, 13, 15, and 20 postinoculation (PI), four chickens from the experimental group and two chickens from the control group were randomly selected and used for sample collection. All were bled before humanly euthanasia. Gross lesions were recorded, and their trachea, lungs, kidneys, caecal tonsil, testes, and oviduct were aseptically collected for virus detection using RT-PCR assay (Table 1). Sera of the birds were collected on 0, 5, 11, 15, and 20 days PI for ELISA test.

The SDS-PAGE was carried out on 12% polyacrylamide gel. The gels were either stained with Coomassie Blue R-250 (Bio-Rad, California, USA) or electroblotted onto Hybond-ECL 0.45 μm nitrocellulose membranes (GE Healthcare) using the Bio-Rad Mini Trans-Blot Cell (Bio-Rad) for Western blot. Briefly, the membrane was blocked with 5% non-fat milk in phosphate buffer saline containing 0.05% Tween-20 (PBS-T) (137 mM NaCl, 2.7 mM KCl, 100 mM Na2HPO4, 2 mM KH2PO4, pH 7.4), incubated with mouse monoclonal antibody (MAb) anti-6xHis (Sigma, USA) diluted to 1:10000 in PBS-T, and incubated with polyclonal antibody Anti-Mouse IgG conjugated to HRP (Sigma). All incubation steps were performed at 37 °C for 1 h under slight agitation followed by three washes with PBS-T. The immunoblot was developed using 3,3′-diaminobenzidine (Sigma).

In summary, the findings of this study support that NDV is an outstanding vaccine vector for expressing an IBV multi-epitope protein as a bivalent vaccine against NDV and IBV. Furthermore, the rNDV-IBV-T/B provides an alternative strategy for the development of a cost-effective and extensively immune-protective vaccine for the control of variant IBV infection.

All applicable institutional guidelines for the care and use of animals were followed in the Central Laboratory for Evaluation of veterinary Biologics (CLEVB).

For immunogold labelling of the mAb tracer, eight μL of tracer sample was deposited onto a glow-discharged carbon-coated grid for 2 min and fixed with 4% paraformaldehyde for 5 min. Following PBS washing, the grid was blocked with 1% (w/v) BSA for 1 h. The grid was then stained with 6-nm gold-conjugated goat anti-mouse IgG (Jackson ImmunoResearch) diluted in blocking solution (1:20) for 1 h and washed three times in PBS. Particles were visualized under a 200-kV high-resolution transmission electron microscope (FEI Tecnai TF20, Hillsboro, OR, USA).

5′ RACE was used to obtain the missing leader sequence (52 bp). The SMARTer 5′ RACE and 3′ RACE kit (Takarabio) was used according to the kit instructions. The gene specific primer used for 5′ RACE was TCAGCTACAGTAGAGGGAGATGTCATAGGTGC. For Sanger sequencing, amplicons was performed using KAPA HiFi HotStart ReadyMixPCR Kit (KAPABiosystems). The primers CTAAAGAGAAGGTGGACACTGGT and CTAAGAATGCGAACTTCACAGAGC were used to amplify the gene 4b homologue region. The primers GTTGTTGTGTTACAAGGCAAGGG and GGATTATGATCAAACCATGAACCTGG were used to amplify the NSP 10/12 region. Cycling conditions used to generate amplicon for Sanger sequencing were: 1 cycle: 95 °C for 3 minutes, 40 cycles: 98 °C for 20 seconds, 65 °C for 15 seconds, 72 °C for 2.5 minutes, and 1 cycle: 72 °C for 3 minutes. Amplicons were cleaned using AMPure XP beads (Beckman Coulter) according to the manufacturer’s directions. Sanger sequencing was performed on the ABI Genetic Analyzer 3130XL platform using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the user manual.

Infectious bronchitis (IB) is an acute and highly contagious respiratory disease of chickens characterized by respiratory signs, and in young chickens by severe respiratory distress and a decrease in egg production in layers.1 The chicken was considered the only natural host of infectious bronchitis virus (IBV) but recently pheasants has been introduced as the other natural host for IBV.2 The disease is transmitted by the respiratory route, direct contact and indirectly through mechanical spread.3 The virus belongs to Coronaviridae, Order Nidovirales. The IBV and other avian coronaviruses of turkeys and pheasants are classified as group 3 coronaviruses.4 Its genome consists of about 27 kb and codes for four structural proteins: the spike (S) glycoprotein, the membrane (M) glycoprotein, the nucleocapsid (N) phosphoprotein, and the envelope (E) protein.5,6 The spike glycoprotein (S) is anchored in the viral envelope and is post-translationally cleaved into two proteins S1 and S2.7 The S protein is very diverse in terms of both nucleotide sequence and deduced primary protein structure, especially in the upstream part of S1.8 Three hypervariable regions (HVRs) have been identified in the S1 subunit.9-11 The S1 subunit induces neutralizing, serotype-specific, and haemagglutination-inhibiting antibodies.12-17 Amino acid changes in the spike (S) glycoprotein lead to the generation of genetic variants.18,19 The high frequency of new IBV variants is a distinguished characteristic of this virus among other coronaviruses.20 Many IBV serotypes have been described probably due to the frequent point mutations that occur in RNA viruses and also recombination events. Therefore, the characterization of virus isolates which exists in the field is very important.21 More than 50 serotypes of IBV have been identified and new variants continued to emerge despite the use of live attenuated and killed IBV vaccines.22-24

The usage of live attenuated vaccines is the most important preventive measure of the disease, but anti-genically different serotypes and newly emerged variants from field chicken flocks sometimes cause vaccine breaks.18,19 The IBV Massachusetts (Mass) type was first detected in Iran by Aghakhan et al.25 In 1998, a virus similar to the European 793/B type was isolated in Iran (Iran/793B/19/08).26 In recent years, new variants of IBV have been reported from different part of the country.27-29 The aim of this study was to provide information on the molecular characteristic and the phylogenetic relationship of prevalent IBV genotypes circulating in chicken flocks in Bushehr province, Iran.

Double immunostaining of cryosections: Frozen tissue sections (5 μm) from OCT preserved tissues were adhered on to positively charged slides, fixed with acetone (4°C) and stained for macrophages and IBV antigens sequentially. After protein blocking with 5% goat serum, the cryosections were incubated for 30 minutes with mouse monoclonal anti-chicken macrophage (KUL01) antibodies (Southern Biotech, Birmingham, Alabama, USA) (1:200 in PBS containing 5% goat serum) and washed three times after incubation. These sections were then stained with the secondary antibody, DyLight® 550 conjugated goat anti-mouse IgG (H+L) (Vector Laboratories, Inc., Burlingame, California, USA) (1:500 in PBS containing 5% goat serum). Before being stained for IBV, the sections were blocked for endogenous avidin /biotin (Vector Laboratories, Burlingame, California, USA). A solution of 5% goat serum was used for 30 minutes for blocking followed by 30 minutes incubation using anti-IBV rabbit polyclonal serum (1:3000) (Federal Research Institute for Animal Health, Greifswald-Insel Riems, Germany). Rabbit IgG was used as the isotype control (Vector Laboratories, Burlingame, California, USA) (1:500). Goat biotinylated anti-rabbit IgG (H+L) (1:400) (Vector Laboratories, Burlingame, California, USA) was used as the secondary antibody. Avidin conjugated with Dylight® 488 (Streptavidin) (Vector Laboratories, Burlingame, California, USA) was used for visualization. In the final step, the sections were mounted on Vectashield® antifade mounting medium with 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) nuclear stain (Vector Laboratories, Burlingame, California, USA). All incubations were carried out at room temperature in a humidifying chamber to prevent drying the sections while on incubation.

IBV antigen quantification in macrophages in vitro: First, macrophages grown on coverslips were subjected to cell wall staining with wheat germ agglutinin conjugated with Alexa Fluor® 594 (Invitrogen, Eugene, OR, USA) as has been instructed by the manufacturer. Then, the cells were fixed with 4% paraformaldehyde before being treated with 0.2% Triton X-100 (SIGMA, Saint Louis, Missouri, USA) for permeabilization. Avidin, biotin and protein blocking was followed by incubation with mouse anti-N monoclonal antibody (Vector Laboratories, Burlingame, California, USA) for 30 minutes (1:400) followed by goat anti-mouse IgG (H+L), which was conjugated to biotin (Vector Laboratories, Burlingame, California, USA) (1:400) for 20 minutes and by avidin conjugated with Dylight® 488 (Streptavidin) (15 μg/ml) (Vector Laboratories, Burlingame, California, USA) for 20 minutes. Finally, coverslips were mounted on glass slides with Vectashield® antifade mounting medium with DAPI nuclear stain (Vector Laboratories, Burlingame, California, USA) and sealed with lacquer.

A previously characterized Brazilian viral sample of IBV Strain Massachusetts 41 (M41- CNPSA – EMBRAPA – Concórdia, SC, Brazil) was propagated after 9 days of incubation in the chorioallantoic cavity of specific pathogen free (SPF) embryonated chicken eggs. The allantoic fluid was then collected and stored at − 70 °C. Viral RNA extraction was carried out with TRIzol® LS reagent (Invitrogen™, EUA), according to the manufacturer’s instructions.

Infectious bronchitis (IB), also called avian infectious bronchitis, is a common, highly contagious, acute, and economically important viral disease of chickens caused by coronavirus infectious bronchitis virus (IBV). The virus is acquired following inhalation or direct contact with contaminated poultry, litter, equipment or other fomites. Vertical transmission of the virus within the embryo has never been reported, but virus may be present on the shell surface of hatching eggs via shedding from the oviduct or alimentary tract. Dozens of serotypes and genotypes of IBV have been detected, and many more will surely be reported in future. The highly transmissible nature of IB and the occurrence and emergence of multiple serotype of the virus have complicated control by vaccination (Saif et al. 2008). To monitor the existing different IBV serotypes in a geographical region, several tests including virus isolation, virus neutralization, hemagglutination inhibition, ELISA and RT-PCR have been employed (Haqshenas et al. 2005; Saif et al. 2008). The ELISA assay is a convenient method for monitoring of both the immune status and virus infection in chicken flocks. Several commercial ELISA kits for IBV specific antibodies detection are already available, which used inactivated virions as coating antigen (Zhang et al. 2005). PCR on reverse transcribed RNA is a potent technique for the detection of IBV. In comparison with classical detection methods, PCR-based techniques are both sensitive and fast (Zwaagstra et al. 1992). Samples for IBV isolation must be obtained as soon as clinical disease signs are evident. Tracheal swabs are preferred and are placed directly into cold media with antibiotics to suppress bacterial and fungal growth and preserve the viability of the virus (Swayne et al. 1998). In Iran, IB is one of the most important viral respiratory diseases of broiler chickens. However, only the Massachusetts vaccine strain is officially authorized. Despite the use of the IBV vaccine it is common to find IBV problems in vaccinated chickens, causing a tremendous economic impact (Nouri et al. 2003). Several serotypes of infectious bronchitis virus have been reported from different parts of Iran (Seyfi-Abad Shapouri et al. 2002; Nouri et al. 2003; Shoushtari et al. 2008). There is no report about the serotypes and molecular detection of IBV in Zabol in the southeast of Iran. The aim of this study was molecular detection of IBV and the IBV serotypes in Zabol.

A/harbor seal/Germany/PV20762_TS/2014 virus was isolated from a tracheal swab of a naturally infected seal (no. 9) during the outbreak in Germany by passaging two times over Madin-Darby canine kidney (MDCK) cells. Virus end-point titrations were performed as described previously. Briefly, MDCK cells were inoculated with tenfold serial dilution of virus stocks, nasal swabs, pharyngeal swabs and homogenized tissue samples. Cells were washed with phosphate-buffered saline solution (PBS) one hour after inoculation and cultured in infection medium, consisting of Eagle’s minimum essential medium (EMEM) supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-glutamine, 1.5 mg/ml NaHC03, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 1X non-essential amino acids (NEAA), and 20 μg/ml trypsin (Lonza). Three days after inoculation, supernatants of cell cultures were tested for agglutinating activity using turkey erythrocytes as an indicator of virus replication in the cells. Infectious virus titers were calculated in quadruplicates of each of the nasal swabs, pharyngeal swabs, and homogenized tissue samples and for ten-fold replicates of the virus stocks by the method of Reed and Munch.

Infectious bronchitis (IB) causes significant economic losses to the poultry industry worldwide [1, 2]. The disease was first identified in North Dakota, USA, when Schalk and Hawn reported a new respiratory disease in young chickens. Since then, IBV has been recognized widely, especially in countries with large commercial poultry populations. Apart from respiratory infections, IB affects the kidney and reproductive tract, causing renal dysfunction and decreased egg production, respectively. Although the disease first was believed to occur primarily in young chickens, however, chickens of all age are also susceptible.

Poultry production in Algeria faces many zootechnical and health constraints, such as viral infections like avian infectious bronchitis (IB). The avian IB virus (IBV), a member of the Coronaviridae family (order Nidovirales and genus Coronavirus), frequently infects broilers and egg-laying hens and leads to severe economic losses to the poultry industry. Since its discovery in the 1930s, the IBV has been identified as the major cause of respiratory infections and poor zootechnical performances. Interestingly, it can also multiply in the renal tissue and cause nephritis, a phenomenon first described in the United States. More recently, IBV-associated nephritis has been accepted as the most pressing problem in broiler flocks in many countries.

The most effective method of protecting poultry from IBV infections is through live or killed vaccines. However, nephritis associated with infectious bronchitis has been observed in several vaccinated flocks, suggesting that the current vaccination strategies against IBV may not provide adequate protection. In fact, outbreaks of IB are frequently caused due to the strains serologically different from those used for vaccination. Since its discovery in 1931, a large number of serotypes or variants of IBV have emerged, and little or no cross-protection occurs between these serotypes. Therefore, it is crucial to track epidemic-causing serotypes in each geographic region or country and produce new vaccines to control IB.

In Algeria, poultry flocks have been vaccinated against IB with the Massachusetts (Mass) strain combined with the IB 4/91 United Kingdom variant strain or 793/B since the past few years. However, kidney damage with suspicion of IB has also been reported in recent years in spite of vaccination but has not been confirmed so far. This has led to the speculation of the possible emergence of variant strains against which conventional vaccines are not completely effective.

The aim of this study was to investigate the presence of IBV among Algerian broiler flocks and its possible involvement in broiler kidney damage. Clinically diseased broiler flocks were sampled and analyzed by the hemagglutination inhibition (HI) test and reverse transcriptase-polymerase chain reaction (RT-PCR) followed by phylogenic analysis.

Morbidity due to IBV infection can reach up to 100%. Mortality rate may range from 25 to 30% in young chicks but may increase to 80% as a result of factors that are host-associated (age, immune status), virus-associated (strain, pathogenicity, virulence, and tissue tropism), or environmental (cold and heat stresses, dust, and presence of ammonia). Secondary bacterial infections (E. coli) or coinfection with immunosuppressive viruses such as Marek's disease virus, infectious bursal disease virus (IBDV) [33, 47, 48], may worsen the outcomes of IBV infection. Generally, nephropathogenic IBV strain causes high mortality, compared with strains infecting only the respiratory or reproductive systems.

The ICS consisted of four main materials as indicated in Figure 3: A sample pad, conjugate pad, nitrocellulose membrane and absorption pad (Prisma Biotech Corporation, Taipei, Taiwan). The sample pad and conjugate pad were first treated with 20 mM phosphate buffer containing 1% BSA, 0.5% tween 20, 0.05% sodium azide and 5% sucrose at pH 7.4; they were subsequently dried at 37 °C. Then, two μL of the mAb LK2-11a gold conjugate (tracer) generated in this study was used on the conjugation pad. The mixture of two mAbs, LK2-12a (0.5 μg) and 2296-4 (0.5 μg) and 0.6 μg of the goat anti-mouse IgG (H+L) (Jackson ImmunoResearch) were loaded onto the NC membrane—serving as a test line and control line, respectively—by means of an XYZ 3050 dispensing platform (BioDot, Irvine, CA) equipped with the BioJet Quanti 3000 dispensers. Upon use, the strip was inserted into the sample solution tube, ensuring the sample pad of ICS was fully reacted with the sample. The results were interpreted within 10 min.

A one step Real time RT-PCR was carried out using Invitrogen kit (SuperScript® III Platinum, Life Technologies, USA). The synthesis of the cDNA first strand was performed using 5 μl total viral RNA primed with a universal pair of primers a) downstream primer, AIBV-fr, targeting N gene nucleotide positions 811–832 (5′-ATGCTCAACCTTGTCCCTAGCA-3′); and b) upstream primer, AIBV-as, targeting N gene nucleotide positions 921–941 (5′-TCAA-ACTGCGGATCA-TCACGT-3′), and the probe TaqMan targeting N gene nucleotide positions 848-875 (5′FAM-TTGGAAGTAGAGTGACGCCCAAACTTCA-3′Tamra).

The amplifications reactions (PCRs) were performed on a Smart Cycler. The following mix of each reaction was contained: 12.5 μl 2 × RT- PCR buffer mix, 0.5 μl MgSO4 (50 mM), 0.5 μl Rox (25 mM), 4.75 μl nuclease free water, 0.5 μl M-MULV reverse transcriptase enzyme (200U), 0.5 μl primers to a final concentration of 10 μM, 0.25 μl probe to a final concentration of 10 μM and 5 μl RNA template. The reaction was carried out in StepOneTM Plus real-time PCR system (Smart cycler Cepheid, USA) at 50 °C for 15 min, 95 °C for 5 min, and 40 cycles of 95 °C for 15 s and 60 °C for 45 s. All reactions amplifications were recorded, analyzed, and the threshold cycle (Ct) determined with the StepOne software (Smart Cycler).

Infectious bronchitis (IB) is primarily a respiratory disease of chickens but with potential to cause more widespread infection in the urinary and reproductive tracts in chicken leading to significant production losses in commercial broiler and layer flocks worldwide. The causative infectious bronchitis virus (IBV) belongs to the family Coronaviridae. The disease is usually characterized by high morbidity and low mortality in mature birds, whereas in naive young birds (2–3 weeks of age), mortality up to 100% can be observed. Being an RNA virus with the ability to mutate and recombine, IBV persist as numerous serotypes and strains. The control of IB relies on vaccination. Vaccines are available for commonly occurring serotypes and strains but they are not necessarily antigenically similar to the wild-type viral strains circulating in poultry barns. Although, these vaccine strains may provide some degree of protection for some related strains known as protectotypes, the commonly available vaccines may not elicit protective immune responses in a flock if the field strains are antigenically very different from the vaccine strains. Owing to this reason, vaccination against IBV is not currently considered to be a very effective control method and other biosecurity measures are necessary to prevent the introduction of IBV into poultry production facilities.

IBV is known to replicate in the respiratory tract leading to changes in the muco-cilliary clearance mechanism, as such, expose the IBV infected birds to secondary bacterial infections. Additionally, IBV has tropisms for a variety of tissues. However, the mode of dissemination from the common route of entry, i.e. the respiratory route, to the rest of the body systems could potentially be due to the initial viremia. Once disseminated, IBV infects epithelial cells of the reproductive and urinary systems, particularly the oviduct and kidney depending on the infecting strain. Recently, it has been shown that a nephro-pathogenic strain of IBV (B1648) could replicate in peripheral blood monocytes leading to viremia. The infection of circulating monocytes could potentially disseminate IBV to the urinary tract, liver and spleen.

Macrophages play roles in innate immune responses, as well as in mounting adaptive immune responses by functioning as antigen presenting cells, as such they are critical in protecting animals from microbial infections. Although it is known that macrophage numbers are elevated in the respiratory tract in response to IBV infection, the role played by macrophages in IBV infection, particularly if they serve as a target cell for viral replication is not known. Macrophages have been implicated to play in an important role in the pathogenesis of some animal and human viruses including Marek’s disease virus in birds, feline corona virus in cats, and human immunodeficiency virus (HIV). It was also shown that coronaviruses such as severe acute respiratory syndrome (SARS)-coronavirus (CoV) can replicate within human macrophages thereby interfering with macrophage functions leading to severe pathology. However, a single report based on in vitro studies indicated that IBV, particularly nonpathogenic Beaudette and Massachusetts type 82822 strains do not replicate in avian macrophages.

Therefore, in this study we investigated the interaction of IBV with macrophages in lungs and trachea in vivo and macrophage cell cultures in vitro using two IBV strains, Connecticut A5968 (Conn A5968) and Massachusetts-type 41 (M41) which are known to induce clinical disease and pathological lesions in chickens. As implicated in some other viruses, we hypothesized that these two strains of IBV replicate within avian macrophages leading to productive replication and interfering with selected macrophage functions in the process.

AL and MO planned and designed the whole study. AL and HM collected samples, performed technique, and analyzed the data. KO and MO supervised the project and helped during manuscript writing, crosschecking, and revision. All authors read and approved the final manuscript.

The chicken embryonic fibroblast cell line (DF-1) and baby hamster kidney fibroblasts clone 13 cell line (BHK-21) were obtained from the American Type Culture Collection (ATCC, Manassas, VA). They were grown in Dulbecco’s minimal essential medium (DMEM) containing 10% fetal bovine serum (FBS). Fertile white leghorn SPF embryonated eggs were purchased from the Beijing Merial Vital Laboratory Animal Technology Co., Ltd. The recombinant avirulent NDV LaSota strain was developed previously in our laboratory by a reverse genetics system. The velogenic NDV genotype IX strain F48E9 and Massachusetts IBV strain M41 obtained from the China Institute of Veterinary Drug Control (Beijing, China) were stored in our laboratory at –70 °C. The 50% embryo infectious dose (EID50) of a virus in harvested allantoic fluid was calculated by the Reed and Muench mathematical technique. All experiments involved standard procedures with the formal approval of the Ethics and Animal Welfare Committee of Shanghai Veterinary Research Institute, China (Approval No. Shvri-po-20180616).