In the current research, 46 broiler flocks were selected for tracheal tissue sample collection. The results of real-time RT-PCR of this study showed that 34 (74.00 %) out of 46 infected flocks were positive to IBV (Fig. 1). 35.00% of positive samples were from Basra, 35.00% of them were from Thi-Qar and 30.00% from Muthana governorates. Amplification of an expected DNA band of 295 bp, and 154bp from positive control, as well as, positive samples indicated that the nested PCR reaction has been performed correctly (Fig. 2). The results of nested PCR revealed that (50.00%), (5.89%), and (44.11%) of these flocks have 793/B, Mass, and unknown strains, subsequently (as shown in Fig. 1). 793/B had the equal prevalence rate in each governorate, but Mass serotype was just detected in Basra governorate. The present study indicated a relatively high prevalence of 793/B IBV genotype in the south of Iraq. D274 genotype was not detected.

Results from a conventional RT-PCR using the IBV N gene confirmed that the obtained RT-PCR products were 130 bp in length, and the PCR products were detectable at a concentration of 100 copies/µl (Fig. 6).

In the past, serological assays such as virus neutralization (VN) and haemagglutination inhibition (HI) were used widely for detecting and serotyping IBV strains. These tests also have been used to measure flock protection following vaccination [50, 51]. Serotype-specific antibodies usually are detected using HI, even though the HI test is less reliable. On the other hand, ELISA assays are more sensitive and easily applied for field use and in monitoring antibody response following vaccination or exposure. However, emergence of different IBV serotypes that do not cross-react with commonly available antisera generally made serological tests less applicable and nonconclusive in classifying new or emerging IBV isolates [52, 53].

The lowest dilution of cDNA that SYBR green I real-time RT-PCR assay was able to detect was an order of magnitude higher than conventional RT-PCR assay (Table 1). Receiver operating characteristic curve analysis of Ct values obtained from the SYBR green I real-time RT-PCR assay indicates the linearity of the reaction and the assay’s efficiency (Fig. 7). The assay has a maximum sensitivity and specificity over a detection range that spanned 104 cDNA gene copies/µl (Table 1).

The cDNA was synthesized using AccuPowder RT PreMix kit (BioNeer Corporation, Republic of Korea) according to the manufacturer's instruction. The primers were specific for 3′ UTR gene. Five μL of total RNA and one μL of each 10 pmol primer were used for cDNA preparation. PCR was performed to amplify a 276-bp fragment of the 3′ UTR gene of avian infectious bronchitis virus. The same primers were used in the PCR master mix containing: 2.5 μL PCR buffer 10X, 0.75 μL MgCl2 (50 mM), 0.5 μL dNTPs (10 mM), 1 μL of each 10 pmol primer (UTR1 and UTR2), 3 μL cDNA, 15.75 μL water, and, at the end, 0.5 μL Taq DNA polymerase (5 IU/μL) was added. The program in Ependorf thermal cycler was 95°C for 3 min and 35 cycles including 95°C for 45 sec., 55.6°C for 45 sec, 72°C for 50 sec, and a postpolymerization step at 72°C for 7 min. The products were analyzed in 1% agarose gel containing ethidium bromide, using an ultraviolet transilluminator.

Several parts of tracheal rings were prepared from each infected bird at 5dpi that coincides with the pic of the clinical signs. At 12 dpi, the ciliary activity was also evaluated from all the infected birds that have recovered. The prepared tracheal rings were immersed immediately in cell culture medium (D-MEM supplemented with 10 % of foetal calf serum), were microscopically analyzed for estimating the ciliary movement in tracheal infected and in tracheal control, and were scored on a scale from 0 (100 % activity) to 4 (no activity). The mean score of each strain was then compared to evaluate the respiratory pathogenicity.

This approach uses viral RNA, amplified either directly (one-step RT-PCR) or following cDNA synthesis (two-step RT-PCR). An RT-PCR assay was designed and introduced in 1991 for detecting the IBV-S2 gene. Subsequently, general and serotype-specific RT-PCR assays were designed to target different regions and/or fragments (Figure 10) in the IBV viral genome [71–73]. The UTR and N-gene-based RT-PCR are used for universal detection, because of the conserved nature of the target region in many IBV serotypes [68, 71]. A pan-coronavirus primer, targeting a conserved region of different coronavirus isolates, could also be used in one-step RT-PCR amplification of IBV strains. However, amplification and sequencing of the S1 gene provide a reliable means for genotypic classification of new IBV strains. A serotype-specific PCR assay has been designed to enable differentiation of Massachusetts, Connecticut, Arkansas, and Delaware field isolates.

All individual samples of trachea, lung and kidney collected at 5 dpi from IBV-infected chickens, were immediately suspended in phosphate-buffered saline (1XPBS), treated by Gentamycin antibiotics (50 μg/g) and clarified by centrifugation at 2500 × g at 4 °C for 25 min. The homogenates samples were used and processed for IBV re-isolation as previously described. It’s was performed by inoculation in allontoic sac route of 9–11 day old eggs, with 100 μl of homogenates and incubation during 6 days (using five eggs by sample) at temperature of 37 °C +/- 2 °C and relative humidity of 75 % +/- 10 %. The embryos were examined for the presence of dwarfism and hemorrhagic traces (on the whole body of the embryo). The RT-PCR detection of viral RNA was performed in parallel with the homogenates tissues and the clarified allontoic fluid.

All tissue samples were immediately stored at −70°C until used. RNA of the samples was extracted using the Accuzol Userś Manual (BioNeer Corporation, Republic of Korea) according to the manufacturer's protocol. Briefly, appropriate tissue (50–100 mg of tissue) was homogenized with 1 mL of Accuzol, and then 200 μL chloroform was added into the mixture and the mixture was centrifuged at 12000 rpm at 4°C for 15 min. The upper phase was added to an equal volume of isopropyl alcohol and stored at −20°C for 10 min then centrifuged at 12000 rpm at 4°C for 10 min. After the washing step, by using 80% ethanol and centrifuging at 12000 rpm at 4°C for 5 min, the pellet was dissolved in a final volume of 50 μL distilled water (DW) and stored at −70°C until used.

In the current research, eleven broiler flocks with age 5–7 weeks were selected for tracheal swab samples preparation. All broiler flocks were vaccinated against infectious bronchitis virus during the first week of life. Amplification of an expected DNA band (466 bp) from positive control as well as IBV positive swab samples indicated that the RT-PCR reaction has been performed correctly (Figure 1a). The results showed that 4 out of 11 (36.36%) of the sampled flocks were positive to IBV by RT-PCR. Specific nested PCR were performed on RT-PCR positive flocks and the Massachusetts was specific serotype of infectious bronchitis virus in broiler flocks of Zabol (Figure 1b).

To validate the use of ICS in clinical settings, a total of 18 throat and cloacal swab samples were collected from IBV 2992/02-infected chickens at one, three and five days post-infection. RT-PCR was used simultaneously as a reference test. Results indicated that ICS successfully detected viral antigens from throat swabs sampled on one (3/3), three (2/3) and five (3/3) days post-infection (dpi), with highly consistent results from RT-PCR (Table 2). For cloacal swabs, viral antigen was not detected until 5 dpi through RT-PCR, in agreement with the findings of the ICS detection. Collectively, the ICS is suitable for early viral detection and reveals sensitivity comparable to that of RT-PCR.

Sampling. Tracheal tissue samples were collected from 46 IB suspected broiler farms, located in Basra, Thi-Qar and Muthana governorates. All chicks were 20-35 day-old and vaccinated with H120 and 4/91. Five tracheal tissue samples per flock were selected for RNA extraction.

RNA extraction and cDNA synthesis. Total RNA was extracted from the tracheas using CinnaPure RNA (Sinaclon Co., Tehran, Iran) based on the kit instructions. The extracted RNA was used in reverse transcription (RT) reaction to generate cDNA through cDNA synthesis kit (Thermo scientific, Waltham, USA). The cDNA was stored at –20 ˚C until use.

Real-time PCR for IBV detection. Real-time PCR was carried out to detect IBV. TaqMan® probe and primers (Bioneer Corporation, Daejeon, Korea) were used in this study according to Callison et al. method.11 Forward primer 5’ GCTTTTGAGCCTAGCGTT3’, reverse primer 5’ GCCATGTTGTCACTGTCTATTG 3’, and TaqMan® dual-labeled probe FAM-CACCACCAGAACCTGTCACCTC-BHQ1, were used to amplify and detect a 143-bp fragment of the 5’-untranslated region (5’UTR). The mixture for each tube was consisted of 13 μL TaqMan Master Mix, 0.2 μL of 2 pM IBV probe, 1 μL of 10 pM forward primer, 1 μL of 10 pM reverse primer, 2.8 μL distilled water, to reach a total volume of 18 μL. Then, 2 μL cDNA was added. A negative control containing nuclease-free water instead of cDNA were included in each run. The thermal profile for the PCR was 95 ˚C for 10 min, followed by 40 cycles of 94 ˚C for 15 sec, 50 ˚C for 30 sec and 72 ˚C for 30 sec. PCR amplification was performed using Rotor Q (Qiagen Co., Hilden, Germany) system.

Nested PCR for IBV genotyping. For determination of genotypes, a type specific nested PCR was conducted.12 Oligonucleotide primers included MCE1+, DCE1+, and BCE1+ which specifically amplified a hyper-variable region of the S1 gene of Mass, D274 and 793/B serotypes, respectively. XCE3- primer was a common primer for all IBV genotypes detection. Primer sequences and their expected band size are shown inTable 1. The first round amplification was performed in a final volume of 20 µL (2 μL distilled water, 13 μL 2X PCR master mix (Sinaclon Co.), 1 μL forward primer (XCE2+) primers, 1 μL reverse primer (XCE2-) and 3 μL cDNA. Amplification was performed with a thermal profile of (94 ˚C for 5 min, 94 ˚C for 45 sec, 58 ˚C for 45 sec, 72 ˚C for 90 sec, and 72 ˚C for 5 min) for 40 cycles. Two microliter of the first round PCR product was diluted with 198 μL of distilled water, whereas in the second round nested PCR we used (2 μL distilled water, 13 μL 2X PCR master mix (Sinaclon Co.), 1 μL forward Primer (XCE3-), 1 μL reverse primer (DCE1+) and or MCE1+, BCE1 + and 3 μL RT-PCR Product) amplification was 94 ˚C for 2 min, 94 ˚C for 15 sec, 48 ˚C for 30 sec, 68 ˚C for 30 sec, and 68 ˚C for 10 min) for 40 cycles. The polymerase chain reaction (PCR) product was analyzed by electrophoresis on 1% agarose gel.

Viral RNA was extracted using the QIAamp viral RNA mini kit (QIAGEN) in accordance with the manufacturer instructions. One-step RT-PCR was performed for IBV screening as previously described. Genotyping with forward and reverse primers for amplification of HVR1, amplicon purification and sequencing was performed as previously described. Obtained sequences in this study aligned with sequences represent all infectious bronchitis virus genotypes proposed by. All samples used in the phylogenetic analysis were downloaded from GenBank (http://www.ncbi.nlm.nih.gov). The sequences were aligned using multiple alignment MAFFT version 7 (https://mafft.cbrc.jp/alignment/server/). The tree was constructed with the MEGA 6 software using the nucleotide substitution of the Hasegawa-Kishino-Yano model with the gamma-distributed rate (with four rate categories) with bootstrap value based on 1000 replicates. Then, the tree was viewed and edited using the FigTree v1.4.2 software (http://tree.bio.ed.ac.uk/software/figtree/).

For the bacteriological investigation, E.coli isolation and confirmation was performed in accordance with. Confirmed, positive E.coli strains were subjected to serotyping using all available O (O1 to O181) antisera in accordance with, cross-reacting antigens were used to ensure the removal of cross-reactivity. All confirmed strains were tested against antibiotics commonly used in Egyptian farms by disc diffusion, with testing procedures and interpretations of the results performed in accordance with reference laboratory protocols. One of the field isolates E.coli (serotype O78) was tested for purity using API 20E (bioMérieux, Inc.) and counted in colony-forming units (CFU).

Based on the results in Tables 1 and 2, the optimum serum dilution ratio for ILTV and IBV were 1:25 and 1:100, respectively. When singleplex xMAP assay was performed. To determine the optimal serum dilition ration for simultaneous detection of ILTV and IBV, a serial serum dilutions from the range of 1:25 to 1:200 were prepared and were incubated with ILTV and IBV antigen conjugated microspheres. From the P/N values showed in Fig. 1, it is obvious that the optimal serum dilution ratio for duplex xMAP assay was 1:100.

The schematic illustration of ICS is indicated in Figure 3. Various samples of avian respiratory pathogens, including the AF (105.5 EID50) of AIV, NDV, ILTV and IBV, were used to test the specificity of the assembled ICS. The test line was found to respond to IBV only but not to other respiratory diseases’ antigens (Figure 4A). The ICS indicated high specificity in IBV antigen detection. In addition, the cross-reactive detection against different strains of the IBV provided by this ICS test was evaluated. Results demonstrated that the ICS was capable of detecting numerous IBV genotypes, including TW-I, TW-II, Mass, and the TW-China variant, but not the non-infectious AF (Figure 4B). Morover, the detection limit against the IBVs was evaluated. As indicated in Table 1, IBV 2575/98 (TW-I) exhibited the best detection limit at 104.4 EID50, followed by H120 (Mass type) at 104.6 EID50, 2992/02 (TW-CN variant) at 104.8 EID50 and IBV 2296/95 (TW-II) at 104.8 EID50.

A singleplex xMAP for ILTV was established by testing six concentrations of the ILTV gD envelope protein (2.5 μg, 5 μg, 10 μg, 20 μg, 40 μg, and 80 μg per 5 × 105 magbeads), seen in Table 1. The P/N value is the ratio of MFI (Median Fluorescence Intensity) value between the positive sample and negative sample. The optimal conjugation protein concentration was 2.5 μg per 5 × 105 magbeads for singleplex xMAP detection of ILTV. The mean P/N value under the condition was 10.18.

A singleplex xMAP for IBV was established by testing six concentrations of the IBV N envelope protein (3 μg, 6 μg, 12 μg, 24 μg, 48 μg, and 96 μg per 5 × 105 magbeads), seen in Table 2. The P/N value is the ratio of MFI value between the positive sample and negative sample. The optimal conjugation protein concentration was 12 μg per 5 × 105 magbeads for singleplex xMAP detection of IBV. The mean P/N value under the condition was 17.16.

Currently, most methods of AIV, NDV, IBV, IBDV and other avian viral agents detection are adapted to specific detection of one agent in a sample. Multiplex RT-PCR is successfully used for detection of AIV and its subtypes [19, 20] and for diagnosing double infections such as combination of NDV and AIV. Also methods with use of multiplex real-time RT-PCR for AIV, NDV and IBV subtypes differentiation have been developed [22–24]. At present development of a test based on microarray technology for simultaneous detection of AIV, NDV, IBV and IBDV in one sample is important for poultry industry in the Republic of Kazakhstan.

Use of microarray improves quality and shortens the analysis duration in molecular diagnosis of infectious diseases and therefore is employed as an independent method in screening for several genes of large numbers of pathology samples [25–27]. There are biochips for influenza diagnosis that allow screening not only for HA and NA, but for M and NP genes of influenza A virus [25, 28]. In identification of NDV molecular methods with use of oligonucleotides specific to conservative regions of NP-gene of NDV were used. Recently VP2 gene region of IBDV is successfully used in synthesis of oligonucleotide primers and probes from highly conservative regions for molecular diagnosis [30–33]. Molecular methods for IBV diagnosis are oriented at using more conservative sequences located in S1 and S2 genes of IBV [34, 35].

In the proposed microarray probes were developed on the basis of conservative regions of gene fragments encoding NP and M (AIV), NP (NDV), VP2 (IBDV), S1 (IBV) array proteins from Genbank Database. All viral gene fragments demonstrated high rate of conservatism and therefore the test is universal for detecting AIV, NDV, IBV and IBDV strains. So, high homology of nucleotide sequences of gene regions encoding AIV, NDV, IBV and IBDV array proteins compared to GenBank data confirms specificity of the developed microarray for rapid diagnosis of avian influenza, Newcastle disease, infectious bronchitis and infectious bursal disease.

Total analysis duration without time required for the viral RNA extraction is 5–6 h, and 16 specimens can be simultaneously assayed. Duration of the assay with use of the proposed microarray is not longer than in other molecular methods and simultaneous testing of samples for AIV, NDV, IBV and IBDV provides its advantage over other methods.

Various methods have been developed for the diagnosis of bird infection, such as virus isolation in cell culture, embryonated chicken eggs, or young specific-pathogen-free (SPF) chickens and localization of the virus in infected tissues by electron microscopy, fluorescence assay, agar immunodiffusion, antigene-capture enzyme-linked immunosorbent assay (ELISA), or immunohistochemistry. All these methods have disadvantages, such as being time consuming, labor intensive, expensive, or nonspecific. These methods lack the ability to detect low levels of antigens in tissues [36–40].

In the present study field samples (122 in total) were used to test effectiveness and reliability of the microarray. Nevertheless, positive result of using molecular and biological methods, being very important in emergency cases, should always be confirmed by the method of virus isolation.

The results of the study show that diagnostic sensitivity (99.16%) and diagnostic specificity (100%) of the DNA microarray are comparable with the same of the real-time RT-PCR (99.15 and 100%, respectively).

Diagnostic effectiveness as percentage ratio of true results to the total number of obtained results for the developed DNA microarray and real-time RT-PCR was 99.18%.

Analysis of the obtained data shows that the microarray test for rapid diagnosis of avian infections demonstrates the effectiveness comparable to that of the molecular method real-time RT-PCR and is more rapid and less resource-consuming owing to its ability to detect simultaneously AIV, NDV, IBV IBDV positive samples in the course of one experiment. Universality of the test makes it suitable for wide use in veterinary laboratories for prompt detection of avian infections.

The developed microarray for rapid diagnosis of avian viral diseases can be used in mass analysis in the system of routine epidemiological surveillance owing to its ability to test one sample for simultaneous detection of AIV, NDV, IBV and IBDV in cases of single and mixed viral infections. At the same time duration of the analysis decreases many times versus classical methods and the proposed scheme of specimen preparation allows conducting assays immediately in small veterinary laboratories thus avoiding transportation of thermolabile RNA.

The study was conducted in years 2015–2016 under the grant research project (Ministry of Education and Science, Republic of Kazakhstan) “Development and testing of microarray for rapid diagnosis of avian viral diseases”, No. 0920/GF 4.

The infectivity of the recombinant virus rNDV-IBV-T/B and parental LaSota strain were characterized using the standard hemagglutination test (HA) and the 50% tissue infectious dose (TCID50) assay on DF-1 cells in 96-well plates, and the 50% egg infective dose (EID50) assay in nine-day-old SPF chicken embryos, according to A Basic Laboratory Manual for the Small-Scale Production and Testing of I-2 Newcastle Disease Vaccine. Virulence of rNDV-IBV-T/B was assessed according to the standard mean death time (MDT) and intracerebral pathogenicity index (ICPI) tests based on the OIE method (http://www.oie.int/en/standard-setting/terrestrial-manual).

The PCR products of all positive samples were purified using PCR Purification Kit (Bioneer Co., South Korea) and were sent for sequencing (Bioneer Co., South Korea). All sequences from a given sample were combined and used to construct alignments. ClustalX (Version 1.83) multiple sequence alignment analysis was performed to calculate the percentage of sequence similarity between our positive samples and sequences of referral strains and other IBV strains. Phylogenetic trees of sequences were constructed by the neighbor-joining method and the Kimura 2-parameter model by MEGA package, Version 5.1 (15). A bootstrap resampling analysis was performed (1000 replicates) to test the robustness of the major phylogenetic groups.

Sampling. Samples were collected from broiler flocks in different regions of Bushehr province as mentioned in Table 1 during 2014-2015. These flocks showed respiratory problems such as gasping, sneezing and bronchial rales. A number of 135 tracheal swabs were taken from fifteen flocks (nine swabs per flock). Each three swabs collected from each flock were pooled in one tube and submitted to Veterinary Diagnostic Laboratory (Tehran, Iran).

RNA extraction Viral RNA was extracted from the directly pooled tracheal swabs in RLT buffer (Qiagen, Hilden, Germany) and 10 μL 2-mercaptoethanol (Merck, Darmstadt, Germany) per 1 mL buffer using RNeasy Mini Kit (Qiagen), according to the manufacturer’s protocol.

Reverse transcription The reverse transcriptation (RT) reaction was performed using ReverAid™ first strand cDNA synthesis kit (Thermo Scientific, Burlington, Canada), according to the product manual. The resultant cDNA was immediately used in a PCR or stored at –20 ˚C for later use.

Amplification of the spike gene Nested reverse transcription polymerase chain reaction (RT-PCR) was performed using spike gene primers as described previously to amplify 392 bp fragment of the spike gene.30 The first round of amplification (495 bp) was performed using SX1 (5ʹ-CACCTAGAGGTTTGT/CTA/TGCAT-´3) and SX2 (5ʹ-TCCACCTCTATAAACACCC/TTT-´3) primers. The PCR reaction was performed in 25 μL reaction mixture containing 1 μL dNTP (10 mM), 0.50 μL of each primer (25 pmol μL-1), 1 μL MgCl2 (50 mM), 2.50 μL 10X PCR buffer, 0.20 μL Taq DNA Polymerase, 2.50 μL cDNA and 16.80 μL dH2O (all from SinaClon, Tehran, Iran). The amplification was performed using 35 thermal cycles including 94 ˚C for 30 sec, 58 ˚C for 30 sec, and 72 ˚C for 30 sec. The PCR product was used as template for the second round of amplification in which SX3 (5´-TAATACTGGC/TAATTT TTCAGA-´3), and SX4 (5ʹ´AATACAGATTGCT TACAACCACC-´3) primers were used. The PCR reaction was carried out under the above condition.

Agarose gel electrophoresis. The PCR products were electrophoresed on 2% agarose gel and visualized by staining with 0.50 μg mL-1 ethidium bromide by UV transilluminator (M-15; UVP, Upland, USA).

PCR product purification. The PCR products were purified using PCR purification Kit (Roche, Mannheim, Germany) according to kit’s manufacture instructions.

Nucleotide sequencing, deduced amino acid analysis and phylogenetic tree. Purified RT-PCR products were sequenced by ABI Prism BigDye terminator cycle sequencing ready reaction kit (Applied Biosystems, Foster City, USA) in a forward direction using primer SX3 and in a reverse direction using primer RX4. Nucleotide sequence of the PCR product (392 bp), which was submitted to NCBI, were compared with the IBV sequences in GenBank database and sequence similarities were analyzed by BLAST. Multiple sequence alignments were carried out with Clustal W and phylogenetic tree was constructed with MEGA software (version 5; Biodesign Institute, Tempe, USA) using the Neighbor-joining tree method with 1000 bootstrap.31

GenBank accession number of IBV sequence. The partial S1 gene sequences of IBVs were submitted to the GenBank database under accession numbers KX578825-KX578834.

This report underscores the need to investigate, by laboratory diagnostic methods, all cases presenting with respiratory distress and drop in egg production for IB. In the present case prior to further laboratory, most clinical diagnoses are based on signs and pathological lesions. Future observation and investigation should be designed to investigate the different IBV serotypes and genotypes in circulation across the country with the aim of producing vaccine (s), based on the identified serotypes, for combating the menace of IB in the Nigerian poultry population.

Viral respiratory diseases are common causes of economic losses in poultry industry. These diseases cause reduction of growth rate and production, high rate of death, prevention and treatment costs. Quick detection and differentiation of causative viruses can play an important role in controlling these viruses.20 IBV and NDV are the viruses that frequently affect the respiratory tract of chickens.21 There are several clinically similar viral diseases that can occur in intensive poultry production and require laboratory differential diagnosis. Infectious bronchitis is a global and highly infectious viral disease,22 and Newcastle disease is also an economically important viral disease in poultry industry.23 Several studies have shown the circulating of different viral respiratory disease including IBV,24-27 NDV28 and avian influenza in Iranian poultry farms.29-31

The duplex RT-PCR assay which can be able to quickly identify IBV and NDV will be of great importance in the epidemiology of these viruses especially for controlling of disease transmission among poultry farms and reduction of the economic losses in poultry industries.32, 33 Because of high sensitivity and specificity that PCR offers, since its introduction researchers use it extensively as an indispensable diagnostic method to detect viruses. Using single PCR takes up much time. Therefore using duplex PCR can solve this restriction of PCR.34

In the present study, developed duplex RT-PCR was able to detect and differentiate two important viral respiratory diseases of poultry and more importantly the technique was able to simultaneously detect infected birds with both viruses. Since the rapid detection of viral infectious agents in intensive poultry production system is very important, this procedure will be useful to detect more than one infectious agent in the infected farms reducing the time and also costs involved.

Because of the importance of avian respiratory pathogens, many researches have undertaken the detection and differentiation of these pathogens especially AIV, IBV and NDV.35-37 A duplex RT-PCR was developed to detect class І and class ІІ strains of NDV. It was shown that this method had high specificity and high sensitivity.38 In another study, Chaharaein et al. used duplex RT-PCR for detecting H5, H7 and H9 subtypes of avian influenza viruses.39

In the present study two farms were co-infected with IBV and NDV viruses. In was concluded that the developed duplex RT-PCR could be a rapid and economic procedure for detection of IBV and NDV in poultry farms. Using this procedure for detecting these viruses in wild birds is also recommended.

One hundred recently succumbed chickens suspected of being IBV infected were collected from forty broiler farms. The study was conducted between late 2017 and early 2018 and samples collected in northern Egypt (Dakahila and Damietta governorates). Lung, trachea, kidney, and liver samples were aseptically collected. On the same day of sampling, half of the organs were cultured for bacteriological investigation in buffered peptone water at 37ºC for 24 h. For IBV screening, lung and trachea samples were homogenized with an equal mass of phosphate buffer saline and then centrifuged at 7,000 × g for 5 min. Supernatant was collected and stored at −80ºC until further investigation.

Developing RT-PCR using vaccinal and reference strains of IBV and NDV. The specificity of duplex-RT-PCR was shown using IB88 and 793/B strains of IBV and two standard strains of NDV. The duplex-RT-PCR products visualize by gel electrophoresis was 433 bp for IBV and 121 bp for NDV (Fig. 1).

Application of developed duplex-RT-PCR for detection and differentiation of IBV and NDV in clinical samples. The applicability of developed duplex-RT-PCR assay for detection and differentiation of IBV and NDV in the diagnosis was validated examining 12 clinical samples as showed in Fig. 2. Among five positive clinical samples belonged to five different broiler farms, three farms were infected with only one virus and two farms were co-infected with IBV and NDV.