This study has been approved by the Health Research Ethics Committee, National Institute of Health Research and Development, Ministry of Health, Indonesia.

Total viral nucleic acid was extracted from 190 μl of viral transport medium using RiboSpin v_RD GeneAll extraction Kit from Seegene (Seegene Inc., Seoul, South Korea). A 10 μl internal control which is inserted in the package was added to each of the 190 μl samples for internal amplification control to check the PCR process. 40 μl elution buffer was added according to the manufacturer instructions. Seeplex® RV16 ACE Multiplex detection (Seegene Inc., Seoul, South Korea), a multiplex real time PCR platform, which is able to detect 16 viruses including human adenovirus (ADV), influenza A and B viruses (Flu A, Flu B), human parainfluenza viruses 1/2/3/4 (PIV 1/2/3/4), human rhinoviruses A/B/C (RV A/B/C), human respiratory syncytial viruses A and B (RSV A, RSV B), human bocaviruses 1/2/3/4 (BoV1/2/3/4), human coronaviruses 229E, NL63 and OC43 (CoV-229E, CoV-NL63, and CoV-OC43), human metapneumovirus (hMPV), and human enterovirus (EV) was used. The protocol followed manufacturer's instruction as described before.

cDNA synthesis process was performed using cDNA synthesis premix (Seegene Inc., Seoul, South Korea) with 8 μl of RNA, 2 μl random hexamer primer, and 10 μl mix of transcriptase, MgCl2, dNTP, and buffer. The multiplex reaction was performed using Biorad CFX 96 Real Time Thermal Cycler. The reaction mixture was first denatured at 95°C for 15 min, followed by 50 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 60 s, extension at 72°C for 30 s, and a final extension step at 55°C for 30 s. The melting curve temperature from 55°C to 85°C (5 s/0, 5°C) was used to read the amplification. Any positive result was detected as a peak in electropherogram, compared to positive control.

From December 2014 to May 2015, adenoid tissue samples were obtained from the 70 patients consecutively admitted for adenoidectomy at the Bonn University Medical Centre, Department of Otorhinolaryngology. Ear, nose and throat specialists determined the indication for surgery. From 45 of these patients, a throat swab was taken just before the surgical procedure. All patients had clinical symptoms caused by hypertrophy of adenoids. At the time of surgery and the 2 weeks before, no children displayed symptoms of acute upper or lower airway infection.

Moderately to severely depressed calves with a high respiratory rate (≥ 65/min) and temperature ≥ 40.0 °C were treated with 0.5 mg/kg meloxicam for pain relief and anti-inflammatory effect. When bacterial pneumonia was suspected, 20 mg/kg procain benzylpenicillin was administered IM once daily for five days. Euthanasia was performed by stunning with a captive bolt, followed by bleed-out.

Extirpated adenoids were picked up in the surgical room and transported on ice to the laboratory for immediate preparation. For nucleic acid preparation, approximately 25 mg of adenoid tissue was crushed mechanically with a scalpel followed by incubation with 600 μL RLT buffer (Qiagen Hilden, Germany) and 1% β-mercaptoethanol (Sigma-Aldrich/Merck, Munich, Germany). The lysate was homogenized by using QIAshredder homogenizer spin columns (Qiagen) according to manufacturer´s instructions. After addition of 1 volume 70% ethanol to the homogenized lysate, RNA was extracted from the sample with the RNeasy Mini Kit (Qiagen) according to the manufacturer´s protocol. All precautions to avoid contamination were strictly adhered to.

SAFV RNA was detected by real-time reverse transcription (RT-)PCR using the primers and probe as previously described, with sequences as follows: CF723: TGTAGCGACCTCACAGTAGCA; CR888: CAGGACATTCTTGGCTTCTCTA; CP797: FAM-AGATCCACTGCTGTGAGCGGTGCAA-BHQ1. RT-PCR was performed in a volume of 25 μL containing 5 μL RNA preparation (approximately 1.25 mg) and by using SuperScriptIII One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen/ThermoFisher Scientific, Schwerte, Germany) and 1 μg bovine serum albumin (VWR International, Langenfeld, Germany). RT and cycling conditions were 52°C for 20 min, denaturation at 94°C for 3 min, followed by 45 PCR cycles, each consisting of 95°C for 15 sec and 58°C for 30 sec. The PCR amplified a 187-bp fragment of the SAFV genome within the 5´ untranslated region (5´UTR). The limit of detection 95% (LOD95) was 9 copies per reaction.

Samples testing positive by RT-PCR were subjected to nested RT-PCR for amplifying a larger genomic stretch, with an inner fragment of approximately 592 bp within the 5´ untranslated region (nucleotide positions [nts] 204–795, according to GenBank number EF165067; without primers, nts 224–775; please note the small SAFV strain-specific differences in fragment length) followed by nucleotide sequencing. SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase and 1 μg BSA was used for first round of amplification and Invitrogen Platinum Taq DNA Polymerase was used for second round amplification. Reaction volume was 25 and 50 μL in the first and second round, respectively, each with 5 μL target. RT and amplification primers were as follows: first round, Cardio-Universal-F1, 5´-GCTAATCAGAGGAAAGTCAGCATT-3´; Cardio-Universal-R1, 5´- GACCACTTGGTTTGGAGAAGCT-3´; second round, Cardio-Universal-F2, 5´-CAGCATTTTCCGGCCCAGGC-3´, Cardio-Universal-R2, 5´-ATCCACGGGGCTTTTGGCCG-3´. RT and cycling conditions were as follows: RT and first round, 48°C for 30 min, 95°C for 5 min, 35 cycles each consisting of 95°C for 1 min, 50°C for 1 min, 72°C for 1 min, followed by 72°C for 5 min; nested PCR, 95°C for 3 min, 35 cycles (94°C for 1 min, 60°C for 1 min, 72°C for 1 min), 72°C for 5 min. Amplified products were visualized on agarose gels and were subjected to DNA cycle sequencing using BigDye Terminator technology (3130XL Genetic Analyzer, Applied Biosystems, Foster City, USA). Sequencing was done in both directions. Sequences were manually reviewed and compared with genome sequences in GenBank.

Viral RNA was quantified by use of an in vitro transcript of a plasmid-based standard (pCR4.0 TOPO-TA vector, ThermoFisher) derived from an 803-bp PCR amplicon encompassing the screening real-time PCR target region.

Throat swabs were taken by flocked swabs (Copan) and were dissolved in 500 μL phosphate-buffered saline. Viral nucleic acid was prepared by use of the QIAamp Viral RNA Mini Kit (Qiagen) and eluted in 100 μL. Testing for SAFV RNA was performed by real-time RT-PCR as mentioned above.

Testing for typical respiratory viruses was performed by RT-PCR as described previously. Tested viruses were Influenza A and B viruses, Human parainfluenza viruses 1–4 (now termed Human respiroviruses 1 and 3, Human rubulaviruses 2 and 4), Human Rhinovirus, Human respiratory syncytial virus, Human metapneumovirus, Enterovirus, Human parechovirus and Human coronaviruses 229E, NL63, HKU-1, and OC43, and Human adenovirus.

To strengthen our findings, we subsequently tested our SAFV-positive tissues and swabs for the non-respiratory viruses Norovirus and Zika virus by use of the RealStar Norovirus RT-PCR Kit 1.0 (Altona Diagnostics) and the RealStar Zika Virus RT-PCR Kit 3.0 (Altona Diagnostics) according to the manufacturer´s protocols.

As HBoV has been first identified in respiratory samples, it has been suggested as a respiratory tract infection agent. The majority of the following studies in fact detected HBoV in children with respiratory tract infections. Clinical symptoms mostly described in conjunction with an HBoV infection are wheezing, fever, bronchiolitis and pneumonia. Studies including asymptomatic controls showed that HBoV is also detectable in these controls but with a lower incidence. For example, HBoV was detected in 17 % of children hospitalized because of respiratory infection, while only 5 % of the surveyed asymptomatic children were HBoV positive. This supports the assumption that HBoV in fact could be assigned to the respiratory viruses.

In contrast to other studies, in the study of Longtin et al. 43 % of asymptomatic children tested positive for HBoV. Most of those children underwent myringotomies, adenoidectomies or tonsillectomies. Thus, Lu et al. suggested that HBoV may be present in tonsillar lymphocytes. They tested DNA extracts of lymphocytes from nasopharyngeal tonsils or adenoids and palatine/lingual tonsils. 32.3 % of the tested extracts were HBoV positive, indicating that HBoV establishes latent or persistent infection.

Coinfections with other viruses are frequently observed in HBoV infections and often occur in more than 50 % of the tested samples. Two recent studies report that the viral load of HBoV was significantly higher in children with monoinfections than in children with coinfections. The high rate of coinfections with other viruses may then be explained by the persistence of HBoV in the respiratory tract. DNA quantification in HBoV positive samples revealed that the viral load of 42.5 % of the positive patients was > 1.0 × 105 DNA copies/mL, suggesting that below this cut-off HBoV may be a persistant virus or a bystander.

Influenza viruses are known to constantly evolve and cross species barriers. The genetic diversity of influenza viruses is ever increasing with more novel influenza subtypes being discovered periodically. The purpose of this review is to provide an up-to-date overview of ecology and evolution of influenza viruses including the novel influenza viruses in bats and cattle. In addition, we discussed the growing complexity of influenza virus–host interactions and highlighted the key research questions that need to be answered for a better understanding of the emergence of pandemic influenza viruses.

Acute respiratory tract infections are major causes of morbidity and mortality. In 2000, lower respiratory tract infections were globally the number one infectious cause of disability adjusted life-years. The commonest respiratory viruses that cause acute upper and lower respiratory tract infections and which are routinely tested for in most virus diagnostic laboratories are: influenza A virus (FLA); influenza B virus (FLB); respiratory syncytial virus (RSV); parainfluenza virus type 1 (PF1); parainfluenza virus type 2 (PF2); parainfluenza virus type 3 (PF3) and adenovirus (ADV). Additionally, human rhinoviruses (HRV) and coronavirus 229E (CoV-229E) are also linked to acute respiratory infection but less commonly included in laboratory reports; human metapneumovirus (hMPV) is not yet part of most United Kingdom virus laboratory test repertoires (personal feed-back from the United Kingdom Clinical Virology Network).

As part of service development it was necessary to provide an alternative to virus culture for testing immunofluorescence negative respiratory specimens. Historically and indeed currently immunofluorescence and virus culture are the main methods used to diagnose acute respiratory virus infections. Culture is accepted as more sensitive than immunofluorescence but slower and therefore less useful for direct patient management decisions. Using a standard culture technique for the culture of respiratory viruses our median reporting times for culture positive and culture negative specimens were 6 days (based on 407 specimens) and 7 days (based on 2159 specimens) respectively; virus identification by this technique required the use of monoclonal antibody staining of the cell monolayer in addition to observation for viral cytopathic effect. We therefore wished to develop a test capable of reporting on immunofluorescence negative specimens within a 24 hour period.

Increasingly however, the sensitivity of nucleic acid amplification techniques for diagnosis has become recognised. However widespread concerns about contamination issues and perceived cost have slowed their widespread adoption. An added problem for acute respiratory tract infections is the relatively large number of viruses that need to be accounted for, a problem which presents specific technical challenges.

One such challenge is the different optimal annealing temperatures of the primer sets for each prospective virus target. The ABI PRISM 7000 real-time facility from Applied Biosystems addresses this by using bundled software to design primer/probe combinations that use a common amplification protocol. However this approach is compromised by the inability of software to allow for target heterogeneity. In addition it does not allow users to adopt clinically validated primer sets from the literature.

To address these problems we adopted an alternative approach through the development of a generic touchdown amplification protocol. Touchdown protocols involve a pre-designed stepped reduction in the annealing temperature used for primer-to-template binding, which introduces a competitive advantage for specific base-pair priming over non-specific priming. A detailed knowledge of the optimum annealing temperature is therefore not required. The study protocol was empirically constructed and proved robust when applied to a large range of respiratory viral and bacterial targets, without compromising individual test sensitivity. It was designed for use with in-house primer master-mixes that recognise 12 common respiratory viruses.

Before deciding on the layout of the molecular strip, as described in the methods, we undertook a wide range of preliminary validation steps for each primer set. The complexity of the strip makes it impossible to fully evaluate using the classical approach of applying an individual gold standard to each virus type. Classically this approach works well where a single target is under investigation. However although the strip is putatively designed to identify 12 viruses, the actual number of individual types targeted is over one hundred and sixty because of the inclusion of generic primer sets for HRV and ADV respectively. The classical approach is further compounded for viruses (a) that cannot be grown or grown easily; (b) for which commercial IF sera are not available; (c) for which specimen panels are not available. We therefore adopted a phased validation, culminating in the present study. Sensitivity was ascribed by undertaking copy number determination on cloned targets and these ranged form 6 × 103 copies per ml for human rhinovirus type 1b to 4.2 × 103 copies/ml for RSV-A. Specificity was ascribed through reproducibility, i.e. specimens which were repeatedly positive, following our standard clinical reporting algorithm, were regarded as true positives; a similar approach was recently described for hMPV. In addition amplicon sequencing was used as an initial specificity check. The primers sets were tested on clinical respiratory specimens arising from a number of ethically approved studies. These included respiratory specimens from patients: (a) with chronic obstructive pulmonary disease; (b) with acute asthma; (c) on assisted ventilation in intensive care. They were also tested on respiratory specimens collected as part of an influenza spotter program as well as on laboratory specimens of known virus reactivity.

To test the feasibility of its routine use we needed to clinically validate its performance in a routine setting on specimens tested in parallel with our standard immunofluorescence protocol for the diagnosis of acute virus respiratory infections. Although the routine immunofluoresence panel lacked capacity for the detection of rhinoviruses, human metapneumovirus and CoV-229E, these were included on the strip for clinical reasons during the period of the study. These findings and their implications are reported.

Antibiotic treatment of bacterial pneumonia must be sufficient in duration and, most crucially, early enough to prevent lesions forming that may resist both therapy and regeneration of normal lung parenchyma. The emphasis should be on early treatment and first treatment success in cases of calf pneumonia since the outcome for those animals that fail to respond successfully to first treatment is poor. Typically, one third to two thirds of animals that do not respond to initial therapy are permanently affected or lost.

The effectiveness of metaphylaxis (defined as mass medication of all animals on arrival in the feedlot) in reducing morbidity rates associated with pneumonia in feedlots is variable. A recent meta-analysis of North American studies estimated a decrease in mortality and morbidity of 2% and 26%, respectively for animals that received antimicrobial treatment on arrival in the feedlot. The average daily weight gain was 0.11 kg higher in these animals in comparison with calves not receiving metaphylactic treatment.

The use of antimicrobials for prevention (prophylaxis or metaphylaxis) of calf pneumonia has to be seen in the context of increasing pressure on the veterinary profession to promote prudent use of antibiotics, noting that indiscriminate use of antibiotics promotes the selection and subsequent proliferation of antibiotic-resistant strains of bacteria. The European Parliament recently called for a review of current practices of prophylactic use of antimicrobials.

Non-steroidal anti-inflammatory drugs (NSAIDs) have shown to reduce pyrexia, clinical signs, and lung pathology, and improve average daily weight gains in calves with respiratory disease compared to untreated calves or calves only treated with antimicrobials. Other studies, however, have not found significant differences between treatment groups. The cost-efficiency of additional anti-inflammatory therapy in bovine respiratory disease is uncertain.

It has been suggested that pneumonic animals should be isolated in appropriate facilities. However, there is little experimental evidence to quantify the benefits and it may lead to practical difficulties.

Influenza is among the major infectious disease problems affecting animal and human health globally. Several human influenza pandemics have been recorded since 1590 AD, with the most significant of those being the “Spanish flu” of 1918, often referred to as the “mother of all pandemics”. Spanish flu pandemic is believed to have affected approximately 25–30 percent of the world’s population and caused more than 50–60 million human deaths globally. Influenza infections in humans occur either as epidemic (seasonal or interpandemic) influenza caused by influenza A and B viruses, or as sporadic pandemic influenza caused by influenza A viruses. Study of influenza pandemics has been of great interest to epidemiologists. Influenza epidemics and pandemics have been repeatedly occurring for centuries, but to date the ability to predict a pandemic has not been achieved.

Pre-term birth children receive intravenous palivizumab to prevent RSV infection. The F-protein epitope recognised by palivizumab seems to be conserved between human and bovine RSV as palivizumab also recognises the F protein of bovine RSV (data not shown). Therefore, like palivizumab, bIgG might be able to prevent infection with hRSV. To this aim GFP-renilla-RSV was pre-incubated with bIgG, IVIg or palivizumab and added to HEp2 cells. After 18–24 hours incubation, cells were harvested and analysed for GFP expression by flow cytometry. Both IVIg and bIgG dose-dependently neutralised RSV, although 6.4 times more bIgG compared to IVIg was needed to inhibit HEp2 cell infection by RSV (IC50: 64 and 10 µg/ml, respectively) (Figure 6B).

Ethical approval is not necessary for such type of study. However, samples were collected as per the standard sample collection procedure without any stress or harm to the animals.

It remains unclear how far HBoV contributes to respiratory and/or gastrointestinal disease. More and more evidence supports the assumption that HBoV is indeed an infectious and contagious agent, but a chance remains that it solely synergistically increases the clinical severity of other infections. Consequently, well planned and designed clinical studies with sophisticated case controls need to be performed in order to finally rule out the role of bocavirus, unless animal or at least in vitro models demonstrate its pathogenicity.

HBoV-IgM antibodies were determined by a commercially available immunoglobulin M (IgM) enzyme-linked immunosorbent assay supplied by (Dako, Glostrup, Denmark) for the quantitative determination of IgM antibodies to HBoV in serum. Briefly: serum samples diluted 1:200 in phosphate buffer saline (PBS) and 0.05% Tween (PBST) were applied in duplicate into wells of plates coated with goat anti-human IgM for 60 min at room temperature. After being rinsed 5 times with PBST, biotinylated HBoV viral like particles (VLPs) were applied at a concentration of 25 ng/well and incubated for 45 min at 37°C. Bound antigen was visualized by using horseradish peroxidase-conjugated streptavidin at 1:12,000 in PBST plus 0.5% bovine serum albumin for 45 min at 37°C, followed by o-phenylenediamine dihydrochloride and H2O2 for 15 min at 37°C. The reaction was stopped after 10 min with 0.5 M H2SO4, and the absorbance at 492 nm were recorded. Cut off absorbance for negative and positive IgM ELISA results were 0.136 and 0.167, respectively.

Qualified personnel monitored the calves morning and evening, and more frequently if deemed necessary. A veterinarian examined all calves on a daily basis until D10, and three to four times a week thereafter throughout the experimental period. When the general health condition of the calves was negatively affected, the frequency of examination was increased. A clinical scoring system was developed, modified after Hägglund et al., and is presented in Table 1. An overall clinical score was calculated by summing up the separate scores from the clinical registrations. The peak outbreak was defined as the day with the highest number of clinically affected calves.

Nasopharyngeal aspirates were collected from patients and control group according to Svensson et al.,. Sterile normal saline solution was instilled in one nostril while occluding the other nostril, using a sterile blunt-tipped disposable syringe. Then the patient was instructed to forcibly exhale through the lavaged side into a sterile specimen cup. The sequence was then repeated in the other side of the nose. NPA specimens were examined microbiologically immediately and part of the specimens was stored in aliquots at -70°C for PCR. Two ml blood samples from both patients and control were collected into vacutainer, centrifuged and serum was separated and stored at - 20°C for HBoV-IgM antibodies by ELISA.

Ninety-three (4.8%) of the 1,926 nasopharyngeal aspirates obtained from patients of all age-groups were positive for HBoV. Our detection rate is similar to that stated in other reports [2, 3, 8]. Generally, HBoV is detected in fewer than 8% of respiratory specimens [1, 8-13]; however, higher detection rates ranging from 10.3% to 19% have been reported [5, 14, 15].

To investigate the epidemiological association of respiratory infection with viral load, HBoV-positive patients were categorized into low- and high-viral-load groups by using 1.0×106 copies/mL as a threshold value. The detection rate of HBoV infection was at its peak in the first year of life (rate of detection, 8.6% between the ages of 6 and 12 months), as in the cases of RSV or PIV infection. Most of the HBoV-positive patients aged less than 3 yr belonged to the high-viral-load group. The detection rate was lower (1.5%) in patients aged more than 10 yr, and these patients belonged exclusively to the low-viral-load group. HBoV is rarely detected in adults except in cases of immunosuppression [10, 16, 17]. The lower detection rate and viral load of HBoV in older patients may be attributed to immunity acquired from an infection at a younger age. A seroepidemiologic study of HBoV showed that 5.6-83.3% of children aged 6 months-3 yr were seropositive for HBoV. Lau et al. suggested that HBoV infection might develop only once because of the subsequent development of life-long immunity conferred by neutralizing antibodies produced in response to the infection.

The frequency of HBoV codetection with other respiratory viruses was 18.3% in the HBoV-positive samples and was lower than the previously published data [4, 20]. This difference in the codetection frequency is attributed to the different detection methods; molecular diagnostic methods were used for the detection of other respiratory viruses in the other studies whereas we used virus culturing. Among the 17 HBoV-positive patients who were also positive for infection with other viruses, 10 showed PIV infection. The high association of HBoV with PIV seems to be attributed to the high prevalence of PIV infection in 2006 (22.8% in May). Interestingly, almost all cases (except two) positive for both HBoV and another respiratory virus belonged to the low-viral-load group. As the virus culture was used for the detection of major respiratory viruses, the isolated virus could be the main causative agent of respiratory illness. Therefore, the presence of low copy number of HBoV, detected by molecular method, may indicate prolonged viral shedding or an asymptomatic infection. Recently, prolonged presence of HBoV in NPAs has been reported. These results suggest that single HBoV infection in the high-viral-load group may play an active role in respiratory infection. These findings are consistent with a Norwegian study that reported detection of HBoV alone and a high-viral-load were associated with respiratory tract infection. In that study, patients with a high-viral-load in NPAs developed viremia more frequently than the patients with a moderate-or a low-viral-load did. In our study, HBoV-positive patients in the high-viral-load group showed significantly higher pulse rates and respiratory rates than the in the low-viral-load group. These findings also support the idea that a high-viral-load may be associated with a respiratory infection.

Previous studies have reported that HBoV infection was more prevalent among individuals who had other respiratory viruses [10, 22]. In a study performed in Hong Kong, a higher detection rate of HBoV was observed in NPAs positive for common respiratory viruses than in those that were negative for the same. However, in our study, similar detection rate of HBoV was observed in the samples positive and negative for other respiratory viruses in the R-mix culture (Data are not shown).

Previous studies showed that cases of HBoV infection were found throughout the year with a peak incidence rate in the winter season [10, 13, 23]. However, in our study, cases of HBoV infection were detected most frequently during the spring season. This finding is similar to those of reports from Korea [4, 24]. This seasonal difference in the incidence of HBoV infection may be attributed to regional and temporal differences.

Bastien et al. suggested that risk factors for severe HBoV infection appear to be similar to those for RSV infection (prematurity, congenital heart disease, and asthma). Thirty percent (26/93) of the HBoV-positive patients had underlying conditions such as heart disease, asthma, allergy, preterm birth, and a history of convulsions; most of these patients (80.8%) showed a low-viral-load. Persistent HBoV shedding for more than 1 month is observed in both respiratory and fecal specimens obtained from patients with significant underlying diseases. Although these finding were not fully understood, it is postulated to be a result of underlying immunosuppression.

In summary, HBoV infection was more prevalent in young children. Patients positive for HBoV alone mainly constituted the high-viral-load group. Most of the HBoV-positive patients with infection caused by other respiratory viruses belonged to the low-viral-load group. These findings suggest that HBoV may be associated with a respiratory infection.

N30 inhibited the replication of H1N1, H3N2, influenza B viruses, including oseltamivir and amantadine resistant strains in vitro. N30 did not directly target the two envelope glycoproteins required for viral adsorption or release. Instead, the compound could depress the activity of IMPDH type II. N30 provided a strong inhibition on the replication of respiratory syncytial virus, coronavirus, enterovirus 71 and a diverse strains of coxsackie B virus.

Real-time PCR for viral load was performed on the specimens positive for HBoV by conventional PCR. A TaqMan probe (5'-ATGTTGCCGCCAGTAACTCCACCC-3') was labeled at the 5' ends with the reporter molecule FAM and at the 3' ends with Black Hole Quencher 1 (Biosearch Technologies, Inc., Novato, CA, USA). The assay was performed using Rotor-Gene 6000 (Corbett Life Science, Sydney, Australia) and the standard protocol of TaqMan universal PCR master mix (Applied Biosystems, Foster City, CA, USA); each 25 µL sample of the reaction mixture contained 10 pg/µL of the forward and the reverse primers and 3 µL of the extracted DNA. Amplification conditions consisted of reactions for 3 min at 50℃, 3 min at 94℃, and 40 cycles of 30 sec at 94℃, 30 sec at 60℃ and 30 sec at 72℃ maintained for 3 min. Detection limit of real-time PCR for HBoV was 1.3×103 copies/mL, which corresponded to 33 copies per reaction.

The aim of this study is to design and assess the diagnostic performance of clinical specimens for the simultaneous identification of RSV and hMPV by using one-step triplex qRT-PCR assay with TaqMan probes. To this aim, we first performed our primer and probe design. Then we used cultured viruses to evaluate the specificity of our primers using qRT-PCR. Finally, we used this established qRT-PCR assay to detect the viral load in nasopharyngeal aspirates.

The study protocol was approved by the medical ethics review board of the College of Medicine, Taif University and by the pediatric hospital ethics committee in accordance with the guidelines for the protection of human subjects. Informed written consents from the next of kin of the participants involved in the study were taken.

In brief, sterile beads were added to the samples, vortexed and processed routinely followed by centrifuged at 2000 rpm for 7 min. Specimens were then decontaminated by adding a 10% antibiotic mixture (Gibco, N.Y.USA) and incubating for 1 h at 4 °C. A volume of 200 μL of sample was inoculated into each of the following cell lines: MRC-5, HEp2, RD, MDCK, and LLCMK2 (ATCC, Manassas, VA, USA). One μΛ of maintenance medium (minimal essential medium with 1% fetal bovine serum) (Gibco, N.Y.USA) was added to each cell line and incubated at 37 °C for 14 days. The CPE was observed every other working day by inverted light microscopy (Olympus, Japan). After CPE appeared, cell smears were prepared and fixed in chilled acetone at −20 °C for 10 min and then tested by fluorescein-conjugated monoclonal antibody in a direct immunofluorescence assay (D3 Ultra 8TM DFA Respiratory Virus Screening & ID Kit, Diagnostic Hybrids, USA). Stained cell smears were examined in a fluorescence microscope at 400× magnification (Olympus, Japan). Un-inoculated cell smear was used as negative control.

bIgG was purified from commercially available bovine colostrum (Colostrum 35% IgG, Reflex Nutrition, Bristol, UK) using an AFFI-T™ column (Kem-en-Tec) followed by a protein G column (5 ml; Amersham). bIgG was eluted with 0.1 M glycine-HCl pH 2.7 elution buffer and neutralised with 1 M Tris-HCl pH 9.0, followed by dialysation against PBS and sterilisation (0.2 µm filter). Fresh milk and colostrum samples were supplied by FrieslandCampina (the Netherlands).

In order to determine at which stage AEBSF treatment blocks RSV A2 infection, we divided the treatment into three stages. At each stage, the medium was changed (Fig. 4a). Pre-inoculation treatment was limited to a treatment of 1 h before inoculation in DMEM without inactivated fetal bovine serum (iFBS) in order to block pre-existing active proteases. Peri-inoculation treatment was comprised of treatment during the 2 h inoculation phase which would inhibit proteases needed for attachment, fusion and uncoating. The post-inoculation phase started when the inoculum was removed 2 h post inoculation and replaced with complete medium. AEBSF was administered to the culture in a final concentration of 0.3 mM in each phase separately or in multiple phases. These time-of-addition experiments indicated that treatment only during the pre-inoculation phase did not result in a significant decrease of the RSV infection. Minor, but significant decreases were observed in the peri-inoculation only treatment, and the post-inoculation treatment only, as well as the combined treatment comprised of pre- and peri-inoculation treatment. Treatment that combines the post-inoculation phase with either the pre- or the peri-inoculation phase did result in a larger significant decrease of RSV infection. The combined peri- and post-inoculation treatment resulted in a nearly complete block that was comparable to the block observed in earlier experiments in which the treatment was comprised of pre-, peri- and post-inoculation treatment.

Given these results, we hypothesized that AEBSF needed to be present during the entry phase of RSV. In order to test this, we adapted the previous setup of the time-of-addition experiments to inoculation for 2 h at 4 °C to induce a more synchronized entry of the virion when the culture was shifted to 37 °C (Fig. 4b). Cells were placed at 4 °C 1 h prior to RSV infection to ensure a completely cooled culture. Cold inoculum was placed on the cells, followed by incubation at 4 °C for 2 h to allow attachment of the virus. Afterwards, the inoculum was removed, the cells were washed once with cold medium to remove unbound particles and complete medium at 37 °C was added to the cells to induce a temperature shift to 37 °C. Cells were further incubated at 37 °C for 18 h, fixed, stained and analyzed by fluorescence microscopy. Treatment during the peri-inoculation phase at 4 °C only did not result in a decrease in RSV infection which we considered normal since the cell metabolism is shut down at 4 °C and the virus particle only attaches at this temperature, however addition of AEBSF at the temperature change in the post-inoculation phase did result in a significant decrease of infected cells. This decrease is similar to the near complete block observed when AEBSF is present during combined peri-inoculation and post-inoculation treatment. These results confirm previous results and suggest that AEBSF treatment of RSV infection is most potent after the attachment of the virion to the host cell and before the start of replication.

Viral nucleic acid was extracted from 200 µl of individual samples using DNA/RNA extraction Kit (Koma Bioteck Inc., Seoul, Korea), according to the manufacturer’s instructions.