Influenza-like illness (ILI) surveillance was conducted in thirteen sentinels' public health center across 13 Indonesia provinces in 2012 in Figure 1. The WHO case definitions were used to determine the ILI cases: fever ≥ 38°C and a cough or a sore throat. Demographic and clinical data were obtained from questionnaires that are filled out by trained staff. Throat swab and nasal swabs from 1,692 patients were collected in viral transport medium (VTM), which were then sent to the Virology Laboratory, National Institute of Health Research and Development (NIHRD) in Jakarta. The VTM consists of bovine serum albumin, penicillin, streptomycin, and amphotericin B, according to WHO surveillance manual. Only specimens were received by the laboratory within three days after the collection was processed for molecular examinations. Specimens were stored in a −80 freezer prior to the laboratory tests. For this multiplex study, a total of three hundred thirty-four specimens were randomly selected.

The descriptive statistics were used to analyse demographics, clinical, and laboratory data using Microsoft Excel (Microsoft Corporation, Washington, US). To compare between single and multiple infection, two paired tests were used.

A total of 1,926 samples of patients with respiratory sym-ptoms were included in the present study. Ninety-three (4.8%) samples were found to be positive for HBoV by PCR and subsequent sequencing. Other respiratory viruses detected during the study period were as follows: influenza A virus (IFA), 56 patients (2.9%); influenza B virus (IFB), 50 patients (2.6%); parainfluenza viruses (PIV), 142 patients (7.4%); respiratory syncytial virus (RSV), 97 patients (5.0%); and adenovirus (ADV), 40 patients (2.1%). HBoV was more prevalent in men (73.1%) than in women (P=0.005).

HBoV was detected in patients ranging from 3 months to 65.6 yr (mean=36.2 months, median=19 months) with a peak prevalence between the ages of 6 and 12 months (8.6%, 22/257). Children aged 5 yr or less constituted 92.5% (86/93) of the HBoV-positive patients (Table 1).

HBoV was detected in the samples obtained throughout the course of the study with the detection rate being the highest in June (16/129, 12.4%), followed by August (9/110, 8.2%) and May (13/162, 8.0%). From April to June 2006, 43% of the HBoV-positive cases were observed (Fig. 1).

All the 93 HBoV-positive cases detected by conventional PCR were also confirmed by real-time PCR performed using the TaqMan probe. The viral load detected in the HBoV-positive samples by using real-time PCR was in the range of 1.3×103-4.6×109 copies/mL (median, 1.82×105 copies/mL). The HBoV-positive cases were categorized in 2 groups: low-viral-load group (viral load ≤1.0×106 copies/mL, N=58) and high-viral-load group (viral load >1.0×106 copies/mL, N=35) (Table 1). The HBoV-positive patients aged less than 3 yr had a significantly higher viral load than that in the patients aged more than 3 yr (P=0.001).

The other respiratory viruses found in 17 (18.3%) of the total HBoV-positive samples were as follows: IFA, 1 sample; IFB, 1 sample; PIV, 10 samples; RSV, 4 samples; and ADV, 1 sample. Most of the cases (88.2%, 15/17) belonged to the low-viral-load group. RSV was isolated from the remaining 2 samples with HBoV copy numbers of 1.09×106 copies/mL and 2.65×108 copies/mL.

Patients positive for HBoV alone had a higher viral load than that in the patients who were positive for both HBoV and another respiratory virus (median 3.78×105 copies/mL vs. 1.94×104 copies/mL, P=0.014). A high-viral-load was almost exclusively seen in the HBoV-positive patients alone (94.3%, 33/35) (Fig. 2).

The high-viral-load group had a significantly higher pulse rate and respiratory rate than the corresponding rates in the low-viral-load group (P=0.007 and P=0.0231, respectively; Table 2). Although the duration of hospital stay was not significantly different between the 2 groups (Table 2), in cases of patients with less than 10 days of hospital stay, the high-viral-load group had a longer hospital stay than the low-viral-load group did (5.2±1.5 days vs. 4.1±1.4 days, P=0.009). Most of the other clinical characteristics had no significant correlation with the viral load of HBoV. The HBoV-positive patients presented with cough (80.6%), sputum (63.4%), fever (62.4%), rhinorrhea (50.5%), crackle (44.1%), wheezing (33.3%), diarrhea (14.0%), and dyspnea (6.5%). No significant difference was observed in the HBoV viral loads in the cases of upper and lower respiratory tract infections (P=0.077). Twenty-one out of 26 patients with underlying conditions had low-viral-loads.

Clinical examination of the HBoV-positive patients showed pneumonia, bronchiolitis, bronchitis, croup, asthma, sinusitis, and pharyngotonsilitis (Fig. 3). HBoV was detected in 8.4% (N=48) and 5.6% (N=45) of the samples obtained from patients with and without pneumonia, respectively (N=572 and 805, respectively; P=0.049). However, no significant difference was observed in the viral load between the patients with and without pneumonia (P>0.05).

Statistical analysis was performed using the SPSS software (version 10, SPSS Inc., Chicago, IL, USA), and graphs were prepared using Prism software (version 4.0, GraPad Software, Inc., San Diego, CA, USA). Mann-Whitney U test, Chi-squared or Fisher's exact test were performed to assess the significance. A P value <0.05 was considered statistically significant for all the tests.

Eighteen (18%) out of the 100 serum samples of the patients with respiratory tract manifestations were positive for HBoV IgM antibodies by ELISA such patients are also positive by PCR, and 82 (82%) specimens were HBoV negative by ELISA. While all 50 serum samples of the controls were negative (table 3). Serum concentration of IgM antibodies against HBoV were detected significantly in patients (0.28 ± 0.06 vs 0.07 ± 0.01 controls), p < 0.001. Table 4 showed the number of positive cases by the different diagnostic methods. Table 5 showed that there was a highly significant association between the PCR and ELISA techniques.

Out of 70 adenoid tissue specimens tested by the screening RT-PCR, eleven (15.7%) were positive for SAFV RNA (Table 1). SAFV-positive cases were from both, males (7/41, 17.1%) and females (4/29, 13.8%). The ages of the SAFV-positive patients ranged from 3 to 10 years (median 5 years). The detailed age distribution of SAFV positives and SAFV negatives is given in Table 2.

SAFV RNA concentration of the positive tissues ranged between <10 and 1x 104 copies/reaction. Three specimens showed values over 1,000 copies/reaction.

In every case of the 11 SAFV-positive adenoid samples, classical respiratory viruses were also found (Table 1), with Enterovirus being the most frequent one (n = 9, 81.8%) followed by Human bocavirus (n = 7, 63.6%) and one of the four Human parainfluenza viruses (n = 5; 45%). SAFV was also detected in combination with Human rhinovirus (n = 2), Human parechovirus (n = 2), Human adenovirus (n = 2), Human respiratory syncytial virus (n = 2), and Human coronaviruses HKU-1 and OC43 (n = 1 each). The number of co-detected viruses ranged between one and six. The non-respiratory viruses Norovirus and Zika virus were not found.

From 45 of the 70 patients tested, a throat swab was collected just before surgery. Thereof, eight throat swabs were from individuals with SAFV-positive adenoids. Two of 45 swabs tested positive for SAFV RNA (Table 1). These two swabs were derived from individuals with SAFV-positive adenoid tissue indicating a rate of 2/8 (25%). Viral load in the swabs was rather low, i. e., 4.5x 102 and 1.1x 102 copies/mL. In both swabs, classical respiratory viruses were also found (case #1, Human rhinovirus; case #2, Human adenovirus and Human bocavirus). None of the throat swabs derived from children with SAFV RNA-negative adenoid tissues tested positive.

Fifteen of the 45 (33%) swabs were negative for any of the tested viruses while 30 yielded at least one virus, albeit at low concentration (Table 3). Most frequently, Human bocavirus was found (10/30 = 33%), followed by Human rhinovirus and Human adenovirus (9/30 each = 30%), Enterovirus (6/30 = 20%), Human parainfluenza viruses (4/30 = 13%), Human coronaviruses (3/30 = 10%), Human parechovirus and Influenza virus A (1/30 = 3% each).

Partial genome sequencing was only successful in three of the SAFV-positive adenoid tissue samples. BLAST alignment of the analyzed PCR product revealed a nearly complete match with the sequences of SAFV2 strains, deposited in the database. Hence, SAFV2 turned out to be the most likely candidate. In the remaining samples, amplification was hampered, most probably because of low viral load.

Diagnostic validity test including sensitivity, specificity, predictive values and efficacy of both HBoV ELISA and PCR were calculated (table 6 and 7) considering PCR as a reference method. In our work we found ELISA to be less sensitive than PCR, it was (81.8% vs 100%), but the specificity of ELISA is higher than PCR, it was (100% vs 78%) (table 6 and 7).

A total of 99 viruses were detected in 84/222 specimens from a total of 79/183 patients and 4/5 National External Quality Assurance Scheme (NEQAS) controls; immunofluorescence did not detect the parainfluenza virus type 2 virus in one of the NEQAS specimens. Viruses were detected in all of the specimen types processed. The molecular strip detected virus in: 16/36 (44.4%) broncho-alveolar lavages, 62/120 (51.6%) nasopharyngeal secretions, 11/35 (31.4%) sputa and 10/31 (32.2%) combined throat and nasal swabs. Immunofluorescence detected virus in: 6/36 (16.6%) broncho-alveolar lavages, 23/120 (19.1%) nasopharyngeal secretions, 1/35 (2.8%) sputa and 1/31 (3.2%) combined throat and nasal swabs.

The median age of male and female patients where virus was detected was 3 y (range 2 weeks – 79 years) and 4 y (5 weeks – 81 years) respectively. Sixteen viruses were detected in 14/27 (51.8%) specimens, confirming a respiratory virus in 12 out of 24 (50%) patients investigated in general practice. Seventy-nine viruses were detected in 70/191 (36.6%) specimens, confirming a respiratory virus in 67 out of 159 (42.1%) patients investigated in hospital. Of the 16 viruses detected in specimens from the community, PCR detected all 16 in contrast to a single identification, influenza A (H3), by immunofluorescence.

The demographic data based on RSV/hMPV one-step triplex qRT-PCR detection in 222 infants hospitalized with respiratory symptoms showed that male patients have higher percentages in RSV or hMPV infection. RSV and hMPV infection cases were significantly associated with severe lung inflammation based on chest X-Ray index. Complication of pneumonia was observed in more than 90% of RSV or hMPV infection patient (Table 6). In addition, we found that RSV or hMPV infection is not associated with C-reactive protein level, indicating the importance of making definite diagnosis in early intervention of RSV and hMPV associated adverse effects, such as severe inflammation and pneumonia.

Extirpated adenoids were picked up in the surgical room and transported on ice to the laboratory for immediate preparation. For nucleic acid preparation, approximately 25 mg of adenoid tissue was crushed mechanically with a scalpel followed by incubation with 600 μL RLT buffer (Qiagen Hilden, Germany) and 1% β-mercaptoethanol (Sigma-Aldrich/Merck, Munich, Germany). The lysate was homogenized by using QIAshredder homogenizer spin columns (Qiagen) according to manufacturer´s instructions. After addition of 1 volume 70% ethanol to the homogenized lysate, RNA was extracted from the sample with the RNeasy Mini Kit (Qiagen) according to the manufacturer´s protocol. All precautions to avoid contamination were strictly adhered to.

SAFV RNA was detected by real-time reverse transcription (RT-)PCR using the primers and probe as previously described, with sequences as follows: CF723: TGTAGCGACCTCACAGTAGCA; CR888: CAGGACATTCTTGGCTTCTCTA; CP797: FAM-AGATCCACTGCTGTGAGCGGTGCAA-BHQ1. RT-PCR was performed in a volume of 25 μL containing 5 μL RNA preparation (approximately 1.25 mg) and by using SuperScriptIII One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen/ThermoFisher Scientific, Schwerte, Germany) and 1 μg bovine serum albumin (VWR International, Langenfeld, Germany). RT and cycling conditions were 52°C for 20 min, denaturation at 94°C for 3 min, followed by 45 PCR cycles, each consisting of 95°C for 15 sec and 58°C for 30 sec. The PCR amplified a 187-bp fragment of the SAFV genome within the 5´ untranslated region (5´UTR). The limit of detection 95% (LOD95) was 9 copies per reaction.

Samples testing positive by RT-PCR were subjected to nested RT-PCR for amplifying a larger genomic stretch, with an inner fragment of approximately 592 bp within the 5´ untranslated region (nucleotide positions [nts] 204–795, according to GenBank number EF165067; without primers, nts 224–775; please note the small SAFV strain-specific differences in fragment length) followed by nucleotide sequencing. SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase and 1 μg BSA was used for first round of amplification and Invitrogen Platinum Taq DNA Polymerase was used for second round amplification. Reaction volume was 25 and 50 μL in the first and second round, respectively, each with 5 μL target. RT and amplification primers were as follows: first round, Cardio-Universal-F1, 5´-GCTAATCAGAGGAAAGTCAGCATT-3´; Cardio-Universal-R1, 5´- GACCACTTGGTTTGGAGAAGCT-3´; second round, Cardio-Universal-F2, 5´-CAGCATTTTCCGGCCCAGGC-3´, Cardio-Universal-R2, 5´-ATCCACGGGGCTTTTGGCCG-3´. RT and cycling conditions were as follows: RT and first round, 48°C for 30 min, 95°C for 5 min, 35 cycles each consisting of 95°C for 1 min, 50°C for 1 min, 72°C for 1 min, followed by 72°C for 5 min; nested PCR, 95°C for 3 min, 35 cycles (94°C for 1 min, 60°C for 1 min, 72°C for 1 min), 72°C for 5 min. Amplified products were visualized on agarose gels and were subjected to DNA cycle sequencing using BigDye Terminator technology (3130XL Genetic Analyzer, Applied Biosystems, Foster City, USA). Sequencing was done in both directions. Sequences were manually reviewed and compared with genome sequences in GenBank.

Viral RNA was quantified by use of an in vitro transcript of a plasmid-based standard (pCR4.0 TOPO-TA vector, ThermoFisher) derived from an 803-bp PCR amplicon encompassing the screening real-time PCR target region.

Throat swabs were taken by flocked swabs (Copan) and were dissolved in 500 μL phosphate-buffered saline. Viral nucleic acid was prepared by use of the QIAamp Viral RNA Mini Kit (Qiagen) and eluted in 100 μL. Testing for SAFV RNA was performed by real-time RT-PCR as mentioned above.

Testing for typical respiratory viruses was performed by RT-PCR as described previously. Tested viruses were Influenza A and B viruses, Human parainfluenza viruses 1–4 (now termed Human respiroviruses 1 and 3, Human rubulaviruses 2 and 4), Human Rhinovirus, Human respiratory syncytial virus, Human metapneumovirus, Enterovirus, Human parechovirus and Human coronaviruses 229E, NL63, HKU-1, and OC43, and Human adenovirus.

To strengthen our findings, we subsequently tested our SAFV-positive tissues and swabs for the non-respiratory viruses Norovirus and Zika virus by use of the RealStar Norovirus RT-PCR Kit 1.0 (Altona Diagnostics) and the RealStar Zika Virus RT-PCR Kit 3.0 (Altona Diagnostics) according to the manufacturer´s protocols.

A total of 222 pediatric patients hospitalized with respiratory symptoms were enrolled from November 2010 through August 2011. Study patients were 61% male and 39% female with a mean age of 0.91 years old (ranges from32 days to 14 years old). The admitting diagnoses of these infants were bronchiolitis (58%), brochopneumonia (24%), and pneumonia (18%). Our one-step triplex qRT-PCR results showed that the viral load of the RSV or hMPV-positive samples from clinical specimens varied over a wide range, presenting threshold between Ct 21 and 44 (21 and 44 cycles). As a result, 68 specimens (30.6%) were found RSV positive, 18 specimens (8.1%) were found hMPV positive by our one-step triplex qRT-PCR. However, standard virus culture only detected 8 RSV positive cases (3.6%) and 0 hMPV cases (0%) (Table 5). In detecting RSV, the major distribution of threshold cycles ranged between Ct 21 and 25 (1,035,656 copies/ reaction ~77,992 copies/reaction). In detecting hMPV, the major distribution of threshold cycles ranged between Ct 31 and 35 (8395 copies/ reaction ~476 copies/ reaction) (Fig. 2).

HBoV detection has been mostly performed on NPAs and swabs and relies mostly on classical and real-time PCR. Real-time PCR sure has advantage over the conventional PCR, as it offers greater sensitivity, specifity, and reduced expenditure of time. PCR assays detecting the NS1 or NP1 gene are most common. Tozer et al. established a highly sensitive real-time PCR assay targeting the NP1 and the VP1 gene and were able to detect HBoV in respiratory samples, as well as in fecal samples and whole blood.

Additional to the PCR assays, HBoV can be detected indirectly via detection of antibodies to HBoV. This method has also been performed with different ELISAs using virus-like-particles (VLP) of HBoV VP1 or VP2. VLPs were produced by using an insect cell line infected with a baculovirus expression vector. These VLPs were then used to produce rabbit anti-serum with high titers of immunoglobulins specific for HBoV, which could be used in the ELISA. All established ELISAs were able to detect anti-HBoV antibodies in sera.

The serum samples were tested using the indirect MonoScreen AbELISA kit (Bio-X Diagnostics S.A, Belgium), according to the manufacturer’s instructions. Samples showing values ≤20% were considered negative, while those showing values between 21% and 40% were considered positive.

Data obtained was double entered into a spreadsheet database prepared with Microsoft® Excel. It was then compared and cleaned for abnormal wrongful entries. Statistical analysis was done using STATA SE statistical software version 11.2(Texas, USA) after the data had been imported. Categorical variables such as age groups and their association with respiratory agents were analyzed using the Fischer's exact test. Continuous variables were expressed as medians with their inter-quartile ranges. A non-parametric K-sample test on the equality of medians was used to evaluate the differences in the medians of the various subgroups of the continuous variables. For all analysis done, a p-value of less than 0.05 was considered statistically significant.

Viral nucleic acids in each sample were extracted using the QIAamp MinElute Virus Spin Kit (QIAGEN GmbH, Hilden, Germany) or QIAamp viral RNA mini kit (QIAGEN). The ResPlex II v2.0 kit (QIAGEN) was used, according to the manufacturer's instructions, to detect 18 human respiratory viruses as follows: respiratory syncytial virus type A (RSVA), respiratory syncytial virus type B (RSVB), influenza A virus (INFA), influenza B virus (INFB), parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, parainfluenza virus type 4, human metapneumoviruses A and B, coxsackievirus/echovirus (CVEV), rhinovirus (RHV), adenovirus type B (ADVB), adenovirus type E, coronavirus NL63 (NL63), coronavirus HKU1, coronavirus 229E (229E), coronavirus OC43 (OC43), and bocavirus (BocV). The principle of this assay is based on multiplex RT‐PCR in combination with fluorescence detection of specific PCR amplicons on the LiquiChip 200 Workstation using QIAplex MDD software.13

Ethical approval is not necessary for such type of study. However, samples were collected as per the standard sample collection procedure without any stress or harm to the animals.

Acute respiratory tract infections are major causes of morbidity and mortality. In 2000, lower respiratory tract infections were globally the number one infectious cause of disability adjusted life-years. The commonest respiratory viruses that cause acute upper and lower respiratory tract infections and which are routinely tested for in most virus diagnostic laboratories are: influenza A virus (FLA); influenza B virus (FLB); respiratory syncytial virus (RSV); parainfluenza virus type 1 (PF1); parainfluenza virus type 2 (PF2); parainfluenza virus type 3 (PF3) and adenovirus (ADV). Additionally, human rhinoviruses (HRV) and coronavirus 229E (CoV-229E) are also linked to acute respiratory infection but less commonly included in laboratory reports; human metapneumovirus (hMPV) is not yet part of most United Kingdom virus laboratory test repertoires (personal feed-back from the United Kingdom Clinical Virology Network).

As part of service development it was necessary to provide an alternative to virus culture for testing immunofluorescence negative respiratory specimens. Historically and indeed currently immunofluorescence and virus culture are the main methods used to diagnose acute respiratory virus infections. Culture is accepted as more sensitive than immunofluorescence but slower and therefore less useful for direct patient management decisions. Using a standard culture technique for the culture of respiratory viruses our median reporting times for culture positive and culture negative specimens were 6 days (based on 407 specimens) and 7 days (based on 2159 specimens) respectively; virus identification by this technique required the use of monoclonal antibody staining of the cell monolayer in addition to observation for viral cytopathic effect. We therefore wished to develop a test capable of reporting on immunofluorescence negative specimens within a 24 hour period.

Increasingly however, the sensitivity of nucleic acid amplification techniques for diagnosis has become recognised. However widespread concerns about contamination issues and perceived cost have slowed their widespread adoption. An added problem for acute respiratory tract infections is the relatively large number of viruses that need to be accounted for, a problem which presents specific technical challenges.

One such challenge is the different optimal annealing temperatures of the primer sets for each prospective virus target. The ABI PRISM 7000 real-time facility from Applied Biosystems addresses this by using bundled software to design primer/probe combinations that use a common amplification protocol. However this approach is compromised by the inability of software to allow for target heterogeneity. In addition it does not allow users to adopt clinically validated primer sets from the literature.

To address these problems we adopted an alternative approach through the development of a generic touchdown amplification protocol. Touchdown protocols involve a pre-designed stepped reduction in the annealing temperature used for primer-to-template binding, which introduces a competitive advantage for specific base-pair priming over non-specific priming. A detailed knowledge of the optimum annealing temperature is therefore not required. The study protocol was empirically constructed and proved robust when applied to a large range of respiratory viral and bacterial targets, without compromising individual test sensitivity. It was designed for use with in-house primer master-mixes that recognise 12 common respiratory viruses.

Before deciding on the layout of the molecular strip, as described in the methods, we undertook a wide range of preliminary validation steps for each primer set. The complexity of the strip makes it impossible to fully evaluate using the classical approach of applying an individual gold standard to each virus type. Classically this approach works well where a single target is under investigation. However although the strip is putatively designed to identify 12 viruses, the actual number of individual types targeted is over one hundred and sixty because of the inclusion of generic primer sets for HRV and ADV respectively. The classical approach is further compounded for viruses (a) that cannot be grown or grown easily; (b) for which commercial IF sera are not available; (c) for which specimen panels are not available. We therefore adopted a phased validation, culminating in the present study. Sensitivity was ascribed by undertaking copy number determination on cloned targets and these ranged form 6 × 103 copies per ml for human rhinovirus type 1b to 4.2 × 103 copies/ml for RSV-A. Specificity was ascribed through reproducibility, i.e. specimens which were repeatedly positive, following our standard clinical reporting algorithm, were regarded as true positives; a similar approach was recently described for hMPV. In addition amplicon sequencing was used as an initial specificity check. The primers sets were tested on clinical respiratory specimens arising from a number of ethically approved studies. These included respiratory specimens from patients: (a) with chronic obstructive pulmonary disease; (b) with acute asthma; (c) on assisted ventilation in intensive care. They were also tested on respiratory specimens collected as part of an influenza spotter program as well as on laboratory specimens of known virus reactivity.

To test the feasibility of its routine use we needed to clinically validate its performance in a routine setting on specimens tested in parallel with our standard immunofluorescence protocol for the diagnosis of acute virus respiratory infections. Although the routine immunofluoresence panel lacked capacity for the detection of rhinoviruses, human metapneumovirus and CoV-229E, these were included on the strip for clinical reasons during the period of the study. These findings and their implications are reported.

As HBoV has been first identified in respiratory samples, it has been suggested as a respiratory tract infection agent. The majority of the following studies in fact detected HBoV in children with respiratory tract infections. Clinical symptoms mostly described in conjunction with an HBoV infection are wheezing, fever, bronchiolitis and pneumonia. Studies including asymptomatic controls showed that HBoV is also detectable in these controls but with a lower incidence. For example, HBoV was detected in 17 % of children hospitalized because of respiratory infection, while only 5 % of the surveyed asymptomatic children were HBoV positive. This supports the assumption that HBoV in fact could be assigned to the respiratory viruses.

In contrast to other studies, in the study of Longtin et al. 43 % of asymptomatic children tested positive for HBoV. Most of those children underwent myringotomies, adenoidectomies or tonsillectomies. Thus, Lu et al. suggested that HBoV may be present in tonsillar lymphocytes. They tested DNA extracts of lymphocytes from nasopharyngeal tonsils or adenoids and palatine/lingual tonsils. 32.3 % of the tested extracts were HBoV positive, indicating that HBoV establishes latent or persistent infection.

Coinfections with other viruses are frequently observed in HBoV infections and often occur in more than 50 % of the tested samples. Two recent studies report that the viral load of HBoV was significantly higher in children with monoinfections than in children with coinfections. The high rate of coinfections with other viruses may then be explained by the persistence of HBoV in the respiratory tract. DNA quantification in HBoV positive samples revealed that the viral load of 42.5 % of the positive patients was > 1.0 × 105 DNA copies/mL, suggesting that below this cut-off HBoV may be a persistant virus or a bystander.

Bacterial isolates were identified using conventional biochemical methods including urease and indole production, citrate utilization, hydrogen sulphide, gas production and fermentation of sugars. The biochemical media used included Simon's Citrate medium, Urea and Triple Sugar Iron agar (TSI). Coagulase tests were performed for all staphylococci organisms.

Serum samples were analyzed by indirect enzyme-linked immunosorbent assays (ELISA) according to the manufacturer’s instructions. This ELISA was done using INgezim antibody test kits for BVDV, BRSV, and BHV-1 (Ingenasa, Madrid, Spain), and Monoscreen ELISA BPI3 (Bio-X Diagnostics, Rochefort, Belgium). The results were read in a microplate photometer, where the optical density (OD) was measured at 450 nm. The cutoff was calculated as A = OD (corrected negative control). Nevertheless, results obtained were expressed as positive and negative based on the manufacturer’s recommended cutoff value for each pathogen.

This study shows that measurement of antibodies in BTM is a very slow changing tool to monitor BRSV in a herd. The antibody level in BTM will remain high for at least four years after a BRSV infection, even without reinfection. A positive BTM sample can be caused by only a few seropositive animals, and even a relatively strong increase in paired BTM test results does not necessarily indicate a new infection. This information is useful when BTM is used both in investigation of outbreaks and for surveillance or control purposes. BTM gives information on a large group of animals and are often readily available, but sampling of young animals will provide better and more updated information of the BRSV status of the herd.

The chi-square tests were employed to compare the BRSV, BoHV-1 and BVDV-1 seropositivity and also with “age group”. Fisher’s exact test was used to compare BRSV status according to the expected prevalence of 80% (≥80%, “high”; < 80%, “low”) and the other variables. Only the variables with p < 0,2 (two-tailed Fisher) were analyzed by a logistic regression model. The analyses were performed using the Epi Info™ program v. 7.0.

BTM samples used in the first and the third studies were collected at the farm by the driver of the milk truck and transported the same day at 4°C to the dairy and were stored at –20°C until they were dispatched by overnight delivery to the laboratory, where they were kept frozen at the same temperature until analysis. The individual samples used in the second and third studies and the BTM samples in study 2 were collected from the herds by the same veterinary surgeon and dispatched by overnight delivery to the laboratory on the same day. Blood and milk samples were centrifuged and the serum or skimmed milk was extracted before being stored at –20°C until they were analysed. An indirect ELISA (SVANOVIR BRSV-Ab, Svanova Biotech AB, Uppsala, Sweden) was used to analyse for antibodies against BRSV, following the manufacturer's instructions. In brief, the optical density (OD) reading of 450 nm was corrected by the subtraction of OD for the negative control antigen, and PP was calculated as (corrected OD/positive control corrected OD)×100. The serum was diluted 1:25 with PBS-Tween buffer and the milk was analysed undiluted as recommended by the manufacturer. A sample was considered positive if PP≥10 and negative if PP<10. Positive and negative controls were used and reproducibility was monitored by use of in-house controls. The ELISA kit is indicated for use in serum and milk samples. The sensitivity and specificity of the tests reported by the manufacturer were 94.6 per cent and 100 per cent, respectively.

We selected 341 clinical specimens from the patients diagnosed as having influenza or influenza‐like illness based on their clinical symptoms and/or the results of rapid tests for influenza. These patients visited the hospitals during the 2006/2007 influenza season (from January 2007 to May 2007), 2007/2008 influenza season (from December 2007 to April 2008), or 2008/2009 influenza season (from September 2008 to February 2009) in Japan. Nasal or pharyngeal samples were collected using UTM 360C kits (Copan Italia, Brescia, Italy) or transport medium consisting of minimum essential medium (MEM) supplemented with 0.5% gelatin, 100 units/mL of penicillin, and 100 µg/mL of streptomycin. These specimens were aliquoted and stored at −80°C until use. The study protocol was approved by the ethics committee of the National Institute of Infectious Diseases, Japan.

Prevalence was determined by dividing the number of positive animals between the total animal of the sampled population. The results obtained were analyzed by the Chi-square test (χ2) to determine the statistical association between the variables, and the odds ratio (OR) was calculated to determine the probability of risk of the analyzed factors. Calculations were made using the SPSS Statistics for Windows, (IBM, USA) version 21.0.