To meet the need for a rapid, efficient and cost-effective diagnosis, multiplex RT-PCR panels, including astroviruses and other gastrointestinal pathogens, have been developed over time. Early attempts using either end-point or qPCR proved to be as efficient as singleplex PCR for the detection in stool samples of HAstVs, noroviruses, adenoviruses, sapoviruses and enteroviruses. In the latter, the analysis of melting curves allowed the determination of dual-infection by the formation of dual peaks, while being at least 10× more sensitive than end-point PCR. Since then, several multiplex assays relying on different formats of detection have been developed and used for the diagnosis of astrovirus infection in humans or animals. Remarkably, among commercially-available solutions, the FilmArray Gastrointestinal Panel (BioFire Diagnostics, Salt Lake City, UT, USA) allows for the simultaneous detection of 22 different enteric pathogens directly from stool specimens, with a reported sensitivity and specificity of 100% and 99.9%, respectively, for the detection of MAstV 1 (but not MAstV 6 and 9), and a turnaround time of around one hour.

Although no systematic evaluation of the clinical benefit of the many existing panels and methods has yet been published, several studies have pointed out the advantages to streamline the diagnosis of presumptive infectious diarrhea with the use of a comprehensive multiplex PCR panel for the detection of known pathogens, and also for the detection of pathogens not requested or unable to be tested by conventional tests. For example, the FilmArray Gastrointestinal Panel has been used to detect astrovirus infections among diarrheic patients who were initially tested negative for Clostridium difficile and/or rotavirus. In another study, the Seeplex Diarrhoea ACE Detection (Seegene, Seoul, Korea) multiplex PCR assay was used in parallel to routine assays, to detect 11 cases of astrovirus infection among 245 stool samples from pediatric patients. Other broad multiplex PCR tests, including the Luminex technology (Austin, TX, USA), have been reported to offer an unprecedented ability to diagnose gastrointestinal infections in immunocompromised patients, with assay performances comparable to the tests examined.

Molecular approaches based on the amplification of viral genome or transcripts have dramatically improved the sensitivity of detection in comparison to EM, immunoassays or virus isolation, making substantial gains. With thresholds of detection as low as 10 to 100 genome copies per gram of stool, and the ability to develop type-specific detection systems, RT-PCR has now become a very common tool for the diagnosis of astrovirus infection in clinical laboratories. However, the design of amplification systems, in particular the intrinsic properties of the primers, are key, especially with regard to the amplification efficiencies and the ability to detect variant strains. For example, among the RT-PCR systems that have been developed for the detection of MAstV 1 (serotypes HAstV 1–8), some are targeting non-coding regions of the virus in a very sensitive and specific manner, while others are designed into conserved motives of the capsid, thereby allowing subsequent typing but with a risk of sub-optimal amplification efficiencies (for a complete review including a table of the most commonly used RT-PCR systems, see).

Alternative to RT-PCR, nucleic acid sequence-based amplification (NASBA) has also shown a good concordance with RT-PCR-based methods for the detection of MAstV 1 (serotypes HAstV 1–8). After the discovery of distant HAstV strains, MLB and VA1/HMO-C, additional primers have been developed and used to describe new populations of viruses. Beyond human astroviruses, many RT-PCR systems were also developed to detect astroviruses in wildlife, livestock or pets. Although consensus primers can detect a large number of astroviruses among both animal and human strains, there is not yet a universal pan-astrovirus RT-PCR system.

In parallel to the development of PCR primers, the application of real-time PCR (qPCR) in a diagnostic setting has improved the diagnosis of astrovirus infections by reducing the risk of false positives, allowing quantitation of viral loads and shortening the time to results (a positive or negative result is usually available within 24 h of specimen collection). qPCR can be done using a nucleic acid stain (typically SYBR green) followed by melting curve analysis, or by the use of a specifically designed hydrolysis probe coupled with a fluorophore (typically Taqman). One-step RT-qPCR methods have also been developed. Further refinements have been proposed with an integrated cell culture/RT-qPCR assay that is able to detect low levels of astrovirus after an incubation of seven days or less, but this approach has remained essentially of interest for research purposes only. Of note, although such advances have brought the ability to detect precise quantification of viral loads, the interpretation of very low amounts of virus in relation to clinical symptoms, especially in asymptomatic individuals, is still not always easy.

Serum samples were analyzed by indirect enzyme-linked immunosorbent assays (ELISA) according to the manufacturer’s instructions. This ELISA was done using INgezim antibody test kits for BVDV, BRSV, and BHV-1 (Ingenasa, Madrid, Spain), and Monoscreen ELISA BPI3 (Bio-X Diagnostics, Rochefort, Belgium). The results were read in a microplate photometer, where the optical density (OD) was measured at 450 nm. The cutoff was calculated as A = OD (corrected negative control). Nevertheless, results obtained were expressed as positive and negative based on the manufacturer’s recommended cutoff value for each pathogen.

A watery, grey diarrhea was noted in the seeder pig 48 hours-post-inoculation with the cell culture-derived challenge material and lasted for approximately 5 days. Approximately 48–72 hours post-exposure with the seeder pig, the contact pigs showed intermittent signs of mild-moderate diarrhea lasting for approximately 7 days. No other clinical signs of diarrhea were appreciated in the contact pigs throughout the remainder of the study. S1, S3, and S4 showed no signs of diarrhea, while S2 had diarrhea for approximately 1 day 24 hours-post-contact with the PG. Post-challenge, the N/C group showed clinical signs of mild diarrhea beginning approximately 48 hours-post-inoculation that lasted for approximately 5 days with intermittent diarrhea in a few pigs for 3 weeks post-challenge. In contrast, no clinical signs were noted in the PG/C pigs post-challenge. The rectal swab fluids were not tested for other enteric pathogens.

Prevalence was determined by dividing the number of positive animals between the total animal of the sampled population. The results obtained were analyzed by the Chi-square test (χ2) to determine the statistical association between the variables, and the odds ratio (OR) was calculated to determine the probability of risk of the analyzed factors. Calculations were made using the SPSS Statistics for Windows, (IBM, USA) version 21.0.

The ELISA test was performed using a previously published method. Briefly, each well of a 96-well microtiter plate (Nalgene Nunc International, Penfield, NY) was coated with 0.44 ng of S1 protein, incubated overnight, and blocked with 1% bovine serum. The 1/100 diluted samples of serum in PBS with 10% goat serum were reacted at 37 °C for 30 min, washed, and incubated with 20 000-fold diluted peroxidase-conjugated goat anti-porcine IgG. Using tetramethylbenzidine-hydrogen peroxide as the substrate, the reaction was visualized for 10 min at room temperature and terminated with 2.5 M sulfuric acid prior to OD measurement at 450 nm. Positive, negative, and blank samples were tested in duplicate on each plate.

This stool was collected in 1984 from a 38 month old child presenting to the emergency department of the Royal Children's Hospital, Melbourne, Australia with acute diarrhea and stored at -80°C. Previous testing of this diarrhea specimen for known enteric pathogens using routine enzyme immunoassays (EIA) and culture assays for rotaviruses, adenoviruses, and common bacterial and parasitic pathogens was negative. Additionally, RT-PCR assays for caliciviruses and astroviruses were also negative.

Proper specimen collection and delivery to a diagnostic lab is commonly neglected, and significantly impacts the diagnostic outcome. Antemortem samples for diagnostic testing should minimally include feces from acutely diarrheic animals prior to therapy with optional blood samples. Necropsy specimens from freshly sacrificed, moribund, or euthanized calves are of great value for diagnosis during severe outbreaks. Fresh and formalin-fixed gastrointestinal tissues (abomasum, small intestine, or colon) including ones from regional lymph nodes and liver should be collected along with colonic contents. Fresh fecal samples should be directly recovered from diarrheic animal into a specimen container with either rectal swabs or by rectal stimulation while avoiding environmental contamination (by soil, urine, or other feces). Once collected, the sample should be stored in a transporting medium or special stool container with refrigeration to maintain pathogen viability and sample integrity (e.g., reduced overgrowth of undesired bacteria and prevention of nucleic acid degradation). Samples of anaerobic bacteria (e.g., C. perfringens) should be kept in an oxygen-free transport medium during shipping if possible.

The chi-square tests were employed to compare the BRSV, BoHV-1 and BVDV-1 seropositivity and also with “age group”. Fisher’s exact test was used to compare BRSV status according to the expected prevalence of 80% (≥80%, “high”; < 80%, “low”) and the other variables. Only the variables with p < 0,2 (two-tailed Fisher) were analyzed by a logistic regression model. The analyses were performed using the Epi Info™ program v. 7.0.

Clinical (e.g., age, vaccination record, and clinical signs) and farm history should be provided to clinicians for determining the cause of diarrhea. Once the specimens are submitted to a veterinary diagnostic laboratory, the diagnostician sorts the samples to ensure proper delivery to testing laboratories based on the history and sample type. Generally, fecal sample are examined by microscopy (for C. parvum and Coccidia), bacterial culturing (for Salmonella spp., E. coli, and C. perfringens), and PCR (for BRV and BCoV). In contrast, intestinal tissues are subjected to immunohistochemistry or bacterial culturing. More recently, nucleic acid-based techniques such as PCR and an antigen-capturing enzyme-linked immunosorbent assay (Ag-ELISA) have been more commonly used for the rapid detection of various bacterial and viral pathogens in clinical specimens from diarrheic calves. When the laboratory test results are available, clinicians should consider the overall farm and clinical history in conjunction with lab results before identifying the causative pathogen.

Serum anti-BCV IgG antibodies were measured by ELISA in 195 samples collected from birth through weaning for 39 calves from Herd 2 that were involved in the mass treatment for BRD on August 12, 2016 in order to determine the mean antibody abundance and range at each sample acquisition time (Fig. 4). The mean (± standard deviation) anti-BCV antibody abundance declined from a maximum of 1186 ± 699 at birth to a low of 138 ± 88 at the time of mass treatment. Mean antibody abundance increased slightly following mass treatment, with mean antibody abundances of 176 ± 83 and 182 ± 95 at preconditioning and weaning, respectively.

Neutralizing antibody titers were measured in 60 of these samples from 12 randomly selected calves to determine the relationship between total anti-BCV reactive antibodies measured by ELISA and neutralizing antibody titers measured by a virus neutralization test (VNT). The effect of altering the strain of the test virus used in the VNT was also evaluated. A high positive mean correlation was observed between the ELISA and VNT assays regardless of the test virus used (Pearson’s rank correlation, ρ = 0.81 with BRCV_2014 strain and ρ = 0.91 with Mebus strain), indicating good to excellent agreement between the two tests under these conditions (Additional file 2). Thus, the ELISA was used for subsequent measurements of anti-BCV antibodies.

The bovine rotavirus-specific RT-LAMP assay specifically amplified strains NCDV-014, and 8 Guangxi field bovine rotavirus strains, which have been isolated from the Guangxi dairy farms, and exhibits no cross-reactivity with other pathogens (Table 1). This specificity was confirmed by agarose gel electrophoresis (Figure 5) and a color change assay (Figure 3). We also determined the assay sensitivity using a 10-fold dilution series. The detection limit of RT-LAMP was 3.32 copies (Figure 2-A). Similarly, the detection limit of real-time RT-PCR analysis was 3.32 copies (Figure 2-B). The results indicate that RT-LAMP is as sensitive as real-time RT-PCR, both of which can detect 3.32 copies of bovine rotavirus VP6 gene.

In comparison with real-time RT-PCR, using the above described procedure with specific primers, 29 rectal swab samples (33.0%) were found positive by both real-time RT-PCR analysis and RT-LAMP, and 59 (70%) were found negative by both tests. As such, the coincidence of real-time RT-PCR and RT-LAMP was 100%. However, RT-LAMP is a quicker, easier, and more cost efficient method than real-time RT-PCR. Restriction enzyme revealed 199-bp target sequence of the VP6 gene of BRV, and sequencing analysis results showed that the clonal sequences of 29 samples were VP6 of BRV. The results indicated no nonspecific amplification in RT-LAMP reaction occurred (data not shown).

120 mg of frozen stool was chipped and then resuspended in 6 volumes of PBS. The sample was centrifuged to pellet particulate matter and the supernatant was then passed through a 0.45 μm filter. Total nucleic acid was isolated from 100 μL primary stool filtrate using QiAmp DNA extraction kit (Qiagen) according to manufacturer's instructions. Total nucleic acid was randomly amplified using the Round AB protocol as previously described. This was then pyrosequenced on a Roche FLX Genome sequencer (Roche) according to manufacturer's protocol. To eliminate sequence redundancy in each library sequences were clustered using BLASTCLUST from the 2.2.17 version of NCBI BLAST. Sequences were clustered based on 98% identity over 98% sequence length and the longest sequence from each cluster was chosen as the representative sequence of the cluster. Unique sequences were filtered for repetitive sequences and then compared with the GenBank nr database by BLASTN and TBLASTX.

Although, over the years the serological methods have turned out to be very productive, the complexity of gastrointestinal virome represents a challenge for the use of such methods. To overcome this, new advances in pathogen detection, including the enteric viruses have shifted toward exploring the immune components, naming serological methods to speed-up the viral diagnosis. The latex agglutination test (LAT) is among the more favored, easiest and rapid methods, and thus is used nowadays as a pen-side test for the identification of several enteric pathogens. Latex beads pre-coated with antibodies against a specific virus are agglutinated when they come into contact with the respective viruses present in the tested sample, forming large agglutinates. This technique was found to be more specific, more sensitive, faster and cheaper in detecting Rotavirus during acute illness when compared to EM or ELISA (Ferreira et al., 2006). Avian IgY antibodies, which have several advantages over the mammalian IgG, have also been employed in immune-chromatography test (ICT) for the rapid detection of Rotavirus (Reschova et al., 2000). ICT-based virus detection strips/kits are also available in the market for the identification and direct detection of Norovirus, Rotavirus, and Astrovirus in fecal samples with good sensitivity and specificity ranging between 90–95% (Khamrin et al., 2009).

One of the most widely used and simple serological diagnostic methods is ELISA and its several modifications are in-use in the form of commercial kits for enteric viruses. Thachil et al. (2015) developed a modified IgG ELISA, based on the S1 portion of the spike protein of porcine delta Coronavirus with high sensitivity (91%) and specificity (95%). An ultrasensitive and fully automated bioluminescent enzyme immunoassay (BLEIA) has been developed for the detection of Norovirus capsid antigen, labeled with firefly luciferase, which possesses a good yield of quantum energy providing high sensitivity (Sakamaki et al., 2012). This method is very useful in the diagnosis of asymptomatic gastroenteritis and has been successful even in the detection of various genotypes of Norovirus (Shigemoto et al., 2014). The results are comparable to other sensitive methods such as ELISA and immunochromatography, can also be applied in the rapid diagnosis of other enteric viruses (Suzuki et al., 2015).

The author’s lab has developed a novel enzyme immunoassay for the detection of Rotavirus A (RVA) antigen in fecal samples of multiple host species with high diagnostic sensitivity and specificity. The concept of this assay was based on the detection of conserved VP6 protein using anti-recombinant VP6 antibodies as capture antibodies and anti-multiple antigenic peptide (constructed from highly immunodominant epitopes within VP6 protein) antibodies as detector antibodies. This assay has already been validated on the fecal samples of four hosts (bovine, porcine, poultry, and human) and also showed a high concordance with diagnostic RT-PCR (Kumar et al., 2016). Recently, a sensitive sandwich ELISA for the detection of NoV genogroup II has been developed that provided an improved detection limit of 13.2 copies/mL fecal suspension for Norovirus as compared to gold-immunoassay (1000-fold) and horseradish peroxidase-based ELISA (100-fold). This assay utilized anti-NoV genogroup II antibodies as capture antibodies and antibodies conjugated to silver ion-incorporated gold nanoparticles (as detection antibody) (Khoris et al., 2019). This ELISA format delivered a significant improvement of sensitivity compared to commercial immunoassay kits.

The presence of antibodies to BRSV was tested by virus neutralization test (VNT). Serum samples were thawed, inactivated in water bath at 56 °C for 30 min, and diluted in duplicates from 1:2 to 1:1024 in 96-well microplates with 50 μL of 200 TCID50 BRSV suspended in Eagle’s minimum essential medium (DIFCO E-MEM®). The viral strain was previously titrated. Following incubation at 37 °C in 5% CO2 atmosphere for 1 h, 50 μL of Madin & Darby Bovine Kidney (MDBK) cells suspension, in E-MEM and 10% bovine fetal serum solution were added to the wells. Then, the plates were re-incubated in similar conditions for 96 h. Each test included a back titration and cell culture control. Samples were positive when cytopathic effect was inhibited at 1:2 dilution, and the titration was expressed as the inverse of the dilution, as geometric mean.

Based on the sequence of the CV777 PEDV strain (GenBank: AF353511.1), seven pairs of oligonucleotide primers (Table 2) were designed to amplify the different regions of the YC2014 genome. The PCR products were cloned into the pUC19 vector using ClonExpress Entry One Step Cloning Kit (Vazyme) and sequenced by Invitrogen Biotechnology (Shanghai, China). The 5′ and 3′ ends of the genome of YC2014 were validated using the rapid amplification of cDNA ends (RACE) cDNA amplification kit (Clontech, Japan). All fragments were sequenced in both directions in triplicate. The complete genomic sequence of YC2014 and the nucleotide sequence of S gene were aligned with sequences of published isolates using MEGA 5.1 software. Phylogenetic trees were constructed using the Maximum Likelihood method and supported with a bootstrap test of 1000 replicates. Genomic sequences of the isolated YC2014 PEDV strain were submitted to GenBank under accession no. KU252649.

Virus isolation was performed as described previously. The RNA of the isolated YC2014 PEDV strain cultures were extracted using the Viral RNA Mini kit (Geneaid Biotech, Taiwan) according to the manufacturer’s instructions. The presence of PEDV in the Vero cell culture was confirmed by reverse transcription PCR (RT-PCR) with one pairs of primers to amplify approximately 1 kb partial sequence of nucleocapsid protein, N1: GCAAACGGGTGCCATTATCTC, N2: CTAGCTCACGAACAGCCACATTAC. The samples of PEDV in the Vero cell culture were confirmed to be negative for rotavirus A, B and C, transmissible gastroenteritis virus (TGEV), porcine respiratory coronavirus (PRCV), caliciviruses and porcine deltacoronavirus via RT-PCR as previously described [15–19].

The PEDV YC2014 strain was then identified with immunofluorescence assay (IFA). Briefly, Vero cells grown on a 6-well plate were infected with the PEDV YC2014 strain. At 48 h post-infection, cells were washed twice with PBS and fixed with cold methanol for 10 min at −20 °C. Cells were then washed three times with PBST and blocked with 10 % bovine serum albumin (BSA) at 37 °C for 1 h. Preparations were incubated for 1 h at 37 °C with mouse anti-PEDV nucleocapsid protein polyclonal antibody in dilution buffer (1 % BSA in PBST), this mouse anti-PEDV nucleocapsid protein polyclonal antibody, prepared by our laboratory, was collected from serum of ICR mice immunized with purified prokaryotic expressed N protein. After three washes with PBST, cells were treated with a rhodamine-conjugated goat anti-mouse IgG (Cwbio, China) at a 1:5000 dilution with PBS for 30 min at 37 °C. After a final four washes with PBST, all wells were examined using fluorescence microscopy (Axio Observer Z1, Zeiss, Germany). After ten passages on Vero cells, the one-step growth curve of YC2014 strain in Vero cells was monitored at 8 h interval after infection.

All calves tested negative for antibodies to BCoV at the beginning of the trial. At D14 all calves in FG and EG had seroconverted (Additional file 1: Table S1). The SG was still seronegative to BCoV D42 and did not show an increase in titer for antibodies to BRSV.

To confirm the specificity of the fragments obtained by RT-PCR, PCR products were purified and used for sequencing. The purposed band, about 450 bp, was excised and then purified using Biomed gel extraction kit (BEIJING BILOMED CO., LTD) according to the manufacturer's instructions. The resulting products were cloned into pMDT-19 simple vector (Takara) for sequencing.

To date, no animal norovirus have been detected in human stool, but some serological evidence hints to possible transmission from animals to humans. This includes a handful of studies that reported seroprevalence against bovine and canine norovirus in humans. A Dutch study compared antibody titres against GIII.2 VLPs from 210 bovine or porcine veterinary specialists against age, sex, and residence matched controls with the aim to evaluate whether higher exposure to animals is reflected in increased titers against animal noroviruses. More veterinarians had anti-GIII.2 IgG antibodies compared to the control group (28% versus 20%). Similarly, the seroprevalence of antibodies to canine GVI.2 VLPs was tested in a cohort of 373 veterinarians versus age, sex, and district matched controls. Of the veterinarians, 22.3% were seropositive for GVI.2 in comparison to 5.8% in the control group. Anti-GIII antibodies were also detected in 26.7% of adult blood donors in Sweden and in a birth cohort in India, which compared seroprevalence of mothers and their children. However, the possible presence of cross-reactive antibodies needs to be considered in these studies: the GIII.2 response was in part correlated with GI.1 response, but not with the GII.4 response. The finding that some sera contained higher antibody titers against GIII.2 than human norovirus indicates that not all anti-GIII.2 response can be explained by cross-reactivity. Importantly, no cross-reactivity between bovine GIII.2 and human GI.3, GII.1, GII.3, GII.4, GII.6 was detected when convalescent anti-GIII.2 sera of a gnotobiotic calf or specific anti-GIII.2 or GII.3 antibodies were used. Cross-reactivity between GVI.2 and GII.4 was assessed by pre-incubating GVI.2 positive sera with GVI.2 VLPs before assessing their binding to GII.4 or GVI.2. Preincubation with GVI.2 blocked binding to GVI.2 VLPs but had no effect on sera binding to GII.4, suggesting that these two genotypes share no conserved epitopes. In contrast, cross-reactivity was observed between more closely related human GIV.1 and canine GIV.2 noroviruses in an age stratified cohort of 535 people in Italy, where 28.2% of the sera reacted to both GIV.1 and GIV.2 VLPs and only 0.9% detected exclusively GIV.2 VLPs.

An orphaned Rothschild giraffe from Dublin Zoological Gardens was presented to the University Veterinary Hospital at 14 days of age with a history failure of passive transfer of immunity, anorexia, dehydration, hypoglycemia, acidosis and persistent profuse watery diarrhea. The animal was treated on admission with intravenous fluid therapy, antimicrobials and non-steroidal anti-inflammatory drugs. The giraffe calf died 4 days post-treatment. A post-mortem examination primarily revealed a severe abomasitis and enteritis. No significant pathogenic organisms were isolated on bacteriological culture of the spleen, rumen or abomasum presumably as a consequence of intensive antimicrobial therapy. A faecal specimen was sent to our laboratory for further investigation.

Preliminary testing of the faecal specimen obtained (by Transmission Electron Microscopy) revealed the specimen to be positive for RV infection. Husbandry issues were considered to assess the potential route of RV infection. Interestingly, the calf had not been in contact with any other ruminants' prior to admission to the University Veterinary Hospital. However indirect contact with other animals could not be out ruled. Other issues for consideration were the movements of the keepers between different animal enclosures, the feeding equipment used and the apparatus used to clean the housing areas.

BCoV RNA was not detected in any of the blood samples analyzed.

Two independent reviewers screened titles and abstracts for their relevance. We included publications that mentioned norovirus in the title or abstract but we excluded papers about food (oyster) and waterborne outbreaks, food surveillance or food related experiments, and oyster/seafood surveillance. We excluded papers on murine noroviruses as models. Papers describing norovirus surveillance in wild mice and papers using mice as model for human norovirus were included (Figure 5).

In a second round, we screened the papers for whether they described (1) animal surveillance studies to detect human or animal norovirus by PCR, sequencing or by serosurveillance including negative results; (2) experimental animal infections with human or animal norovirus; (3) human surveillance studies to detect animal norovirus by PCR, sequencing or by serosurveillance including negative results; (4) animal norovirus characterization including molecular assays and genome announcements.

Nucleic acids were extracted from 340 porcine stool samples. PBoV1-H18 related sequences were screened for using nested PCR with primers amplifying a 530-bp fragment of the NP1/VP1 region. The electrophoretic bands of the expected size were subcloned and sequenced. The results showed that the prevalence of PBoV1-H18 related viruses was high in China with 215 out of 340 (63.2%) porcine samples positive (Table 1). All PBoV1-H18 related sequences showed >99% identity with each other. For PBoV2-A6 nested PCR, 219 out of 340 (64.4%) samples were positive (Table 1), with the amplicons showing 90% to 100% identity with each other. 133 out of 340 (39.1%) samples were co-infected with both PBoV1-H18 and PBoV2-A6 related viruses (Table 1).